Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 22, Number 5—May 2016

Research

Expansion of Shiga Toxin–Producing Escherichia coli by Use of Bovine Antibiotic Growth Promoters

Jong-Chul Kim, Linda Chui, Yang Wang, Jianzhong Shen, and Byeonghwa JeonComments to Author 
Author affiliations: University of Alberta, Edmonton, Alberta, Canada (J.-C. Kim, L. Chui, B. Jeon); Beijing Key Laboratory of Detection Technology for Animal-Derived Food Safety at China Agricultural University, Beijing, China (Y. Wang, J. Shen)

Main Article

Table 1

Primers used in study of expansion of Shiga toxin–producing Escherichia coli by bovine antibiotic growth promoters

Primer Sequence, 5′ → 3′ Reference
Pro_Stx2-F TAAGCATCTAGATTGCAGGATTAGTTACGT This study
Pro_Stx2-R
TGCTTATCTAGAACAGGTGTTCCTTTTGGC
GFP_BGL_F TTCGAGCTCAGATCTCGGGGATCC This study
GFP_BGL_R
TGCTTAAGATCTCGCATTAAAGCTTGCATG
pkD13-F CCAGGCTCGCTTTTGCGGGCCTTTTTTAT This study
pkD13-R
GTGACACAGATTACACTTGTTACCCACAT
Kt CGGCCACAGTCGATGAATCC (20)
K2
CGGTGCCCTGAATGAACTGC
Stx2-F GTCTGGTGCTGATTACTTCAGCCAA This study
Stx2-R
ATTACACTTGTTACCCACATACCAC
eaeA-F GACCCGGCACAAGCATAAGC (21)
eaeA-R
CCACCTGCAGCAACAAGAGG
Ec1_uspA CCGATACGCTGCCAATCAGT (22)
Ec2_uspA
ACGCAGACCGTAAGGGCCAGAT
O157F CGGACATCCATGTGATATGG (21)
O157R TTGCCTATGTACAGCTAATCC

Main Article

References
  1. Organisation for Economic Co-operation Development. Global antimicrobial use in the livestock sector. 2015 [cited 2015 Jul 1]. http://www.oecd.org/officialdocuments/publicdisplaydocumentpdf/?cote=TAD/CA/APM/WP(2014)34/FINAL&docLanguage=En
  2. Union of Concerned Scientists. Hogging it: estimates of antimicrobial abuse in livestock. 2001 [cited 2015 Jul 1]. http://www.ucsusa.org/food_and_agriculture/our-failing-food-system/industrial-agriculture/hogging-it-estimates-of.html#.VuAuafJf3IU
  3. United States Department of Agriculture. Feedlot 2011 part IV: health and health management on U.S. feedlots with a capacity of 1,000 or more head. 2013 [cited 2015 Jul 1]. https://www.aphis.usda.gov/animal_health/nahms/feedlot/downloads/feedlot2011/Feed11_dr_PartIV.pdf
  4. Giguère  S, Prescott  JF, Dowling  PM. Antimicrobial therapy in veterinary medicine. 5th ed. Ames (IA): Wiley-Blackwell; 2013. p. 495–518.
  5. Nagaraja  TG, Chengappa  MM. Liver abscesses in feedlot cattle: a review. J Anim Sci. 1998;76:287–98 .PubMedGoogle Scholar
  6. Gustafson  RH, Kiser  JS. Nonmedical uses of the tetracyclines. In: Hlavka JJ, Boothe JH, editors. The tetracyclines. New York: Springer Science; 2012. p. 405–39.
  7. Croxen  MA, Finlay  BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol. 2010;8:26–38 .PubMedGoogle Scholar
  8. Johnson  KE, Thorpe  CM, Sears  CL. The emerging clinical importance of non-O157 Shiga toxin–producing Escherichia coli. Clin Infect Dis. 2006;43:1587–95. DOIPubMedGoogle Scholar
  9. Gould  LH, Mody  RK, Ong  KL, Clogher  P, Cronquist  AB, Garman  KN, Increased recognition of non-O157 Shiga toxin–producing Escherichia coli infections in the United States during 2000–2010: epidemiologic features and comparison with E. coli O157 infections. Foodborne Pathog Dis. 2013;10:453–60. DOIPubMedGoogle Scholar
  10. Allison  HE. Stx-phages: drivers and mediators of the evolution of STEC and STEC-like pathogens. Future Microbiol. 2007;2:165–74. DOIPubMedGoogle Scholar
  11. Toshima  H, Yoshimura  A, Arikawa  K, Hidaka  A, Ogasawara  J, Hase  A, Enhancement of Shiga toxin production in enterohemorrhagic Escherichia coli serotype O157:H7 by DNase colicins. Appl Environ Microbiol. 2007;73:7582–8. DOIPubMedGoogle Scholar
  12. Kimmitt  PT, Harwood  CR, Barer  MR. Toxin gene expression by Shiga toxin–producing Escherichia coli: the role of antibiotics and the bacterial SOS response. Emerg Infect Dis. 2000;6:458–65. DOIPubMedGoogle Scholar
  13. Davis  TK, McKee  R, Schnadower  D, Tarr  PI. Treatment of Shiga toxin–producing Escherichia coli infections. Infect Dis Clin North Am. 2013;27:577–97. DOIPubMedGoogle Scholar
  14. Nguyen  Y, Sperandio  V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2012;2:90.
  15. Etcheverría  AI, Padola  NL. Shiga toxin–producing Escherichia coli: factors involved in virulence and cattle colonization. Virulence. 2013;4:366–72. DOIPubMedGoogle Scholar
  16. Callaway  TR, Elder  RO, Keen  JE, Anderson  RC, Nisbet  DJ. Forage feeding to reduce preharvest Escherichia coli populations in cattle, a review. J Dairy Sci. 2003;86:852–60DOIPubMedGoogle Scholar
  17. Naylor  SW, Low  JC, Besser  TE, Mahajan  A, Gunn  GJ, Pearce  MC, Lymphoid follicle-dense mucosa at the terminal rectum is the principal site of colonization of enterohemorrhagic Escherichia coli O157:H7 in the bovine host. Infect Immun. 2003;71:1505–12. DOIPubMedGoogle Scholar
  18. Pruimboom-Brees  IM, Morgan  TW, Ackermann  MR, Nystrom  ED, Samuel  JE, Cornick  NA, Cattle lack vascular receptors for Escherichia coli O157:H7 Shiga toxins. Proc Natl Acad Sci U S A. 2000;97:10325–9. DOIPubMedGoogle Scholar
  19. Sagi  E, Hever  N, Rosen  R, Bartolome  AJ, Rajan Premkumar  J, Ulber  R, Fluorescence and bioluminescence reporter functions in genetically modified bacterial sensor strains. Sens Actuators B Chem. 2003;90:2–8. DOIGoogle Scholar
  20. Datsenko  KA, Wanner  BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000;97:6640–5. DOIPubMedGoogle Scholar
  21. Paton  AW, Paton  JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol. 1998;36:598–602 .PubMedGoogle Scholar
  22. Chen  J, Griffiths  MW. PCR differentiation of Escherichia coli from other gram-negative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein. Lett Appl Microbiol. 1998;27:369–71. DOIPubMedGoogle Scholar
  23. Valdivia  RH, Falkow  S. Bacterial genetics by flow cytometry: rapid isolation of Salmonella typhimurium acid-inducible promoters by differential fluorescence induction. Mol Microbiol. 1996;22:367–78. DOIPubMedGoogle Scholar
  24. Herold  S, Siebert  J, Huber  A, Schmidt  H. Global expression of prophage genes in Escherichia coli O157:H7 strain EDL933 in response to norfloxacin. Antimicrob Agents Chemother. 2005;49:931–44. DOIPubMedGoogle Scholar
  25. Marshall  BM, Levy  SB. Food animals and antimicrobials: impacts on human health. Clin Microbiol Rev. 2011;24:718–33. DOIPubMedGoogle Scholar
  26. Aarestrup  FM. Occurrence, selection and spread of resistance to antimicrobial agents used for growth promotion for food animals in Denmark: chapter 1: introduction. APMIS. 2000;108:5–6. DOIGoogle Scholar
  27. US Food and Drug Administration. 2013 Summary report on antimicrobials sold or distributed for use in food-producing animals. 2015 [cited 2015 Jul 1]. http://www.fda.gov/downloads/ForIndustry/UserFees/AnimalDrugUserFeeActADUFA/UCM440584.pdf
  28. European Medicines Agency. Sales of veterinary antimicrobial agents in 26 EU/EEA countries in 2012. 2014 [cited 2015 Jul]. http://www.ema.europa.eu/docs/en_GB/document_library/Report/2014/10/WC500175671.pdf
  29. Cazer  CL, Volkova  VV, Grohn  YT. Use of pharmacokinetic modeling to assess antimicrobial pressure on enteric bacteria of beef cattle fed chlortetracycline for growth promotion, disease control, or treatment. Foodborne Pathog Dis. 2014;11:403–11. DOIPubMedGoogle Scholar
  30. O'Connor  AM, Ziebell  KA, Poppe  C, McEwen  SA. Verotoxins in commensal Escherichia coli in cattle: the effect of injectable subcutaneous oxytetracycline in addition to in-feed chlortetracycline on prevalence. Epidemiol Infect. 2004;132:77–85. DOIPubMedGoogle Scholar
  31. Sarmah  AK, Meyer  MT, Boxall  AB. A global perspective on the use, sales, exposure pathways, occurrence, fate and effects of veterinary antibiotics (VAs) in the environment. Chemosphere. 2006;65:725–59. DOIPubMedGoogle Scholar
  32. Elmund  GK, Morrison  SM, Grant  DW, Nevins  SM. Role of excreted chlortetracycline in modifying the decomposition process in feedlot waste. Bull Environ Contam Toxicol. 1971;6:129–32. DOIPubMedGoogle Scholar
  33. Zhao  L, Dong  YH, Wang  H. Residues of veterinary antibiotics in manures from feedlot livestock in eight provinces of China. Sci Total Environ. 2010;408:1069–75DOIPubMedGoogle Scholar
  34. McGannon  CM, Fuller  CA, Weiss  AA. Different classes of antibiotics differentially influence Shiga toxin production. Antimicrob Agents Chemother. 2010;54:3790–8. DOIPubMedGoogle Scholar
  35. Zhang  X, McDaniel  AD, Wolf  LE, Keusch  GT, Waldor  MK, Acheson  DW. Quinolone antibiotics induce Shiga toxin–encoding bacteriophages, toxin production, and death in mice. J Infect Dis. 2000;181:664–70. DOIPubMedGoogle Scholar
  36. Cornick  NA, Helgerson  AF, Mai  V, Ritchie  JM, Acheson  DW. In vivo transduction of an Stx-encoding phage in ruminants. Appl Environ Microbiol. 2006;72:5086–8. DOIPubMedGoogle Scholar

Main Article

Page created: April 13, 2016
Page updated: April 13, 2016
Page reviewed: April 13, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external