Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 24, Number 1—January 2018

Research

Detection and Circulation of a Novel Rabbit Hemorrhagic Disease Virus in Australia

Jackie E. Mahar, Andrew J. Read, Xingnian Gu, Nadya Urakova1, Roslyn Mourant, Melissa Piper, Stéphanie Haboury, Edward C. Holmes, Tanja Strive, and Robyn N. HallComments to Author 
Author affiliations: Commonwealth Scientific and Industrial Research Organisation (CSIRO), Acton, Australian Capital Territory, Australia (J.E. Mahar, N. Urakova, R. Mourant, M. Piper, S. Haboury, T. Strive, R.N. Hall); The University of Sydney, Sydney, New South Wales, Australia (J.E. Mahar, E.C. Holmes); Elizabeth Macarthur Agricultural Institute, Menangle, New South Wales, Australia (A.J. Read, X. Gu); Invasive Animals Cooperative Research Centre, Bruce, Australian Capital Territory, Australia (N. Urakova, T. Strive, R.N. Hall)

Main Article

Table 1

Primers and probes used for RHDV and RHDVa detection by real-time reverse transcription PCR in isolates from rabbits, Australia*

Name Sense Sequence, 5′ → 3′ Strain Reference
vp60–7_FOR + ACY TGA CTG AAC TYA TTG ACG RHDV
(34)
vp60–8_REV – TCA GAC ATA AGA AAA GCC ATT GG (34)
vp60–9_FAM
Probe
CCA ARA GCA CRC TCG TGT TCA ACC T–FAM-BHQ1
Modified from (34)
RHDVXa2010-F1 + GCACCCGGCAGTATTCTC RHDVa This study
RHDVXa2010-R1 – CCCAGCCAGCGTACATCTG This study
RHDVXa2010-P1 Probe ACTGTCCAACACTCTCCACAGAACA–FAM-BHQ1 This study

*RHDV, rabbit hemorrhagic disease virus; vp, viral protein; +, positive; –, negative.

Main Article

References
  1. Abrantes  J, van der Loo  W, Le Pendu  J, Esteves  PJ. Rabbit haemorrhagic disease (RHD) and rabbit haemorrhagic disease virus (RHDV): a review. Vet Res (Faisalabad). 2012;43:12. DOIPubMedGoogle Scholar
  2. Delibes-Mateos  M, Ferreira  C, Carro  F, Escudero  MA, Gortázar  C. Ecosystem effects of variant rabbit hemorrhagic disease virus, Iberian Peninsula. Emerg Infect Dis. 2014;20:2166–8. DOIPubMedGoogle Scholar
  3. Cooke  B, Chudleigh  P, Simpson  S, Saunders  G. The economic benefits of the biological control of rabbits in Australia, 1950–2011. Aust Econ Hist Rev. 2013;53:91–107. DOIGoogle Scholar
  4. Pedler  RD, Brandle  R, Read  JL, Southgate  R, Bird  P, Moseby  KE. Rabbit biocontrol and landscape-scale recovery of threatened desert mammals. Conserv Biol. 2016;30:774–82. DOIPubMedGoogle Scholar
  5. Cooke  BD, Fenner  F. Rabbit haemorrhagic disease and the biological control of wild rabbits, Oryctolagus cuniculus, in Australia and New Zealand. Wildl Res. 2002;29:689–706. DOIGoogle Scholar
  6. O’Hara  P. The illegal introduction of rabbit haemorrhagic disease virus in New Zealand. Rev Sci Tech. 2006;25:119–23. DOIPubMedGoogle Scholar
  7. Eden  J-S, Kovaliski  J, Duckworth  JA, Swain  G, Mahar  JE, Strive  T, et al. Comparative phylodynamics of rabbit hemorrhagic disease virus in Australia and New Zealand. J Virol. 2015;89:9548–58. DOIPubMedGoogle Scholar
  8. Wirblich  C, Thiel  HJ, Meyers  G. Genetic map of the calicivirus rabbit hemorrhagic disease virus as deduced from in vitro translation studies. J Virol. 1996;70:7974–83.PubMedGoogle Scholar
  9. Meyers  G, Wirblich  C, Thiel  HJ. Genomic and subgenomic RNAs of rabbit hemorrhagic disease virus are both protein-linked and packaged into particles. Virology. 1991;184:677–86. DOIPubMedGoogle Scholar
  10. Le Gall-Reculé  G, Zwingelstein  F, Laurent  S, de Boisséson  C, Portejoie  Y, Rasschaert  D. Phylogenetic analysis of rabbit haemorrhagic disease virus in France between 1993 and 2000, and the characterisation of RHDV antigenic variants. Arch Virol. 2003;148:65–81. DOIPubMedGoogle Scholar
  11. Lavazza  A, Capucci  L. Chapter 2.6.2. Rabbit haemorrhagic disease. In: OIE manual of diagnostic tests and vaccines for terrestrial animals. 2016 [cited 2017 Jan 13]. http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.06.02_RHD.pdf
  12. Capucci  L, Fallacara  F, Grazioli  S, Lavazza  A, Pacciarini  ML, Brocchi  E. A further step in the evolution of rabbit hemorrhagic disease virus: the appearance of the first consistent antigenic variant. Virus Res. 1998;58:115–26. DOIPubMedGoogle Scholar
  13. Schirrmeier  H, Reimann  I, Köllner  B, Granzow  H. Pathogenic, antigenic and molecular properties of rabbit haemorrhagic disease virus (RHDV) isolated from vaccinated rabbits: detection and characterization of antigenic variants. Arch Virol. 1999;144:719–35. DOIPubMedGoogle Scholar
  14. Wang  X, Hao  H, Qiu  L, Dang  R, Du  E, Zhang  S, et al. Phylogenetic analysis of rabbit hemorrhagic disease virus in China and the antigenic variation of new strains. Arch Virol. 2012;157:1523–30. DOIPubMedGoogle Scholar
  15. Oem  JK, Lee  KN, Roh  IS, Lee  KK, Kim  SH, Kim  HR, et al. Identification and characterization of rabbit hemorrhagic disease virus genetic variants isolated in Korea. J Vet Med Sci. 2009;71:1519–23. DOIPubMedGoogle Scholar
  16. Burmakina  G, Malogolovkina  N, Lunitsin  A, Titov  I, Tsybanov  S, Malogolovkin  A. Comparative analysis of rabbit hemorrhagic disease virus strains originating from outbreaks in the Russian Federation. Arch Virol. 2016;161:1973–9. DOIPubMedGoogle Scholar
  17. Abrantes  J, Lopes  AM, Dalton  KP, Parra  F, Esteves  PJ. Detection of RHDVa on the Iberian Peninsula: isolation of an RHDVa strain from a Spanish rabbitry. Arch Virol. 2014;159:321–6. DOIPubMedGoogle Scholar
  18. Le Gall-Reculé  G, Lavazza  A, Marchandeau  S, Bertagnoli  S, Zwingelstein  F, Cavadini  P, et al. Emergence of a new lagovirus related to Rabbit Haemorrhagic Disease Virus. Vet Res (Faisalabad). 2013;44:81. DOIPubMedGoogle Scholar
  19. Dalton  KP, Nicieza  I, Balseiro  A, Muguerza  MA, Rosell  JM, Casais  R, et al. Variant rabbit hemorrhagic disease virus in young rabbits, Spain. Emerg Infect Dis. 2012;18:2009–12. DOIPubMedGoogle Scholar
  20. Abrantes  J, Lopes  AM, Dalton  KP, Melo  P, Correia  JJ, Ramada  M, et al. New variant of rabbit hemorrhagic disease virus, Portugal, 2012-2013. Emerg Infect Dis. 2013;19:1900–2. DOIPubMedGoogle Scholar
  21. Baily  JL, Dagleish  MP, Graham  M, Maley  M, Rocchi  MS. RHDV variant 2 presence detected in Scotland. Vet Rec. 2014;174:411. DOIPubMedGoogle Scholar
  22. Duarte  M, Henriques  M, Barros  SC, Fagulha  T, Ramos  F, Luís  T, et al. Detection of RHDV variant 2 in the Azores. Vet Rec. 2015;176:130. DOIPubMedGoogle Scholar
  23. Hall  RN, Mahar  JE, Haboury  S, Stevens  V, Holmes  EC, Strive  T. Emerging rabbit hemorrhagic disease virus 2 (RHDVb), Australia. Emerg Infect Dis. 2015;21:2276–8. DOIPubMedGoogle Scholar
  24. Dalton  KP, Nicieza  I, Abrantes  J, Esteves  PJ, Parra  F. Spread of new variant RHDV in domestic rabbits on the Iberian Peninsula. Vet Microbiol. 2014;169:67–73. DOIPubMedGoogle Scholar
  25. Lopes  AM, Correia  J, Abrantes  J, Melo  P, Ramada  M, Magalhães  MJ, et al. Is the new variant RHDV replacing genogroup 1 in Portuguese wild rabbit populations? Viruses. 2014;7:27–36. DOIPubMedGoogle Scholar
  26. Westcott  DG, Frossard  JP, Everest  D, Dastjerdi  A, Duff  JP, Steinbach  F, et al. Incursion of RHDV2-like variant in Great Britain. Vet Rec. 2014;174:333. DOIPubMedGoogle Scholar
  27. Puggioni  G, Cavadini  P, Maestrale  C, Scivoli  R, Botti  G, Ligios  C, et al. The new French 2010 Rabbit Hemorrhagic Disease Virus causes an RHD-like disease in the Sardinian Cape hare (Lepus capensis mediterraneus). Vet Res (Faisalabad). 2013;44:96. DOIPubMedGoogle Scholar
  28. Camarda  A, Pugliese  N, Cavadini  P, Circella  E, Capucci  L, Caroli  A, et al. Detection of the new emerging rabbit haemorrhagic disease type 2 virus (RHDV2) in Sicily from rabbit (Oryctolagus cuniculus) and Italian hare (Lepus corsicanus). Res Vet Sci. 2014;97:642–5. DOIPubMedGoogle Scholar
  29. Lopes  AM, Marques  S, Silva  E, Magalhães  MJ, Pinheiro  A, Alves  PC, et al. Detection of RHDV strains in the Iberian hare (Lepus granatensis): earliest evidence of rabbit lagovirus cross-species infection. Vet Res. 2014;45:94.PubMedGoogle Scholar
  30. Hall  RN, Peacock  DE, Kovaliski  J, Mahar  JE, Mourant  R, Piper  M, et al. Detection of RHDV2 in European brown hares (Lepus europaeus) in Australia. Vet Rec. 2017;180:121. DOIPubMedGoogle Scholar
  31. Mahar  JE, Nicholson  L, Eden  JS, Duchêne  S, Kerr  PJ, Duckworth  J, et al. Benign rabbit caliciviruses exhibit evolutionary dynamics similar to those of their virulent relatives. J Virol. 2016;90:9317–29. DOIPubMedGoogle Scholar
  32. Office International des Epizooties. Rabbit haemorrhagic disease, Australia—immediate notification report. Ref OIE = 14719. 2014 [cited 2017 Jan 16]. http://www.oie.int/wahis_2/public/wahid.php/Reviewreport/Review?page_refer=MapFullEventReport&reportid=14719
  33. Collins  BJ, White  JR, Lenghaus  C, Morrissy  CJ, Westbury  HA. Presence of rabbit haemorrhagic disease virus antigen in rabbit tissues as revealed by a monoclonal antibody dependent capture ELISA. J Virol Methods. 1996;58:145–54. DOIPubMedGoogle Scholar
  34. Gall  A, Hoffmann  B, Teifke  JP, Lange  B, Schirrmeier  H. Persistence of viral RNA in rabbits which overcome an experimental RHDV infection detected by a highly sensitive multiplex real-time RT-PCR. Vet Microbiol. 2007;120:17–32. DOIPubMedGoogle Scholar
  35. Strive  T, Wright  JD, Robinson  AJ. Identification and partial characterisation of a new Lagovirus in Australian wild rabbits. Virology. 2009;384:97–105. DOIPubMedGoogle Scholar
  36. Jahnke  M, Holmes  EC, Kerr  PJ, Wright  JD, Strive  T. Evolution and phylogeography of the nonpathogenic calicivirus RCV-A1 in wild rabbits in Australia. J Virol. 2010;84:12397–404. DOIPubMedGoogle Scholar
  37. Elsworth  P, Cooke  BD, Kovaliski  J, Sinclair  R, Holmes  EC, Strive  T. Increased virulence of rabbit haemorrhagic disease virus associated with genetic resistance in wild Australian rabbits (Oryctolagus cuniculus). Virology. 2014;464-465:415–23. DOIPubMedGoogle Scholar
  38. Hall  RN, Capucci  L, Matthaei  M, Esposito  S, Kerr  PJ, Frese  M, et al. An in vivo system for directed experimental evolution of rabbit haemorrhagic disease virus. PLoS One. 2017;12:e0173727. DOIPubMedGoogle Scholar
  39. Kearse  M, Moir  R, Wilson  A, Stones-Havas  S, Cheung  M, Sturrock  S, et al. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9. DOIPubMedGoogle Scholar
  40. Guindon  S, Gascuel  O, Rannala  B. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 2003;52:696–704. DOIPubMedGoogle Scholar
  41. Posada  D. jModelTest: phylogenetic model averaging. Mol Biol Evol. 2008;25:1253–6. DOIPubMedGoogle Scholar
  42. Martin  DP, Murrell  B, Golden  M, Khoosal  A, Muhire  B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015;1:vev003 .
  43. Liu  J, Kerr  PJ, Strive  T. A sensitive and specific blocking ELISA for the detection of rabbit calicivirus RCV-A1 antibodies. Virol J. 2012;9:182. DOIPubMedGoogle Scholar
  44. Liu  J, Kerr  PJ, Wright  JD, Strive  T. Serological assays to discriminate rabbit haemorrhagic disease virus from Australian non-pathogenic rabbit calicivirus. Vet Microbiol. 2012;157:345–54. DOIPubMedGoogle Scholar
  45. Cooke  BD, Robinson  AJ, Merchant  JC, Nardin  A, Capucci  L. Use of ELISAs in field studies of rabbit haemorrhagic disease (RHD) in Australia. Epidemiol Infect. 2000;124:563–76. DOIPubMedGoogle Scholar
  46. Lopes  AM, Dalton  KP, Magalhães  MJ, Parra  F, Esteves  PJ, Holmes  EC, et al. Full genomic analysis of new variant rabbit hemorrhagic disease virus revealed multiple recombination events. J Gen Virol. 2015;96:1309–19. DOIPubMedGoogle Scholar
  47. Bergin  IL, Wise  AG, Bolin  SR, Mullaney  TP, Kiupel  M, Maes  RK. Novel calicivirus identified in rabbits, Michigan, USA. Emerg Infect Dis. 2009;15:1955–62. DOIPubMedGoogle Scholar
  48. MacLachlan  NJ. Parvoviridae A2. In: Dubovi EJ, editor. Fenner’s veterinary virology. 5th edition. Boston: Academic Press; 2017. p. 245–57.
  49. Cox  TE, Liu  J, de Ven  RV, Strive  T. Different serological profiles to co-occurring pathogenic and non-pathogenic caliciviruses in wild European rabbits (Oryctolagus cuniculus) across Australia. J Wildl Dis. 2017;53:472–81. DOIPubMedGoogle Scholar
  50. Matthaei  M, Kerr  PJ, Read  AJ, Hick  P, Haboury  S, Wright  JD, et al. Comparative quantitative monitoring of rabbit haemorrhagic disease viruses in rabbit kittens. Virol J. 2014;11:109. DOIPubMedGoogle Scholar

Main Article

1Current affiliation: University of Alabama at Birmingham School of Medicine, Birmingham, Alabama, USA.

Page created: January 09, 2018
Page updated: January 09, 2018
Page reviewed: January 09, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external