Volume 28, Number 12—December 2022
Research
Development of Differentiating Infected from Vaccinated Animals (DIVA) Real-Time PCR for African Horse Sickness Virus Serotype 1
Table 2
Primer/probe | Sequence, 5′ → 3′ | Sense | Position |
---|---|---|---|
VP5-DIVA-F | 5′ AGCGTCGGATGCAAAGAAATC 3′ | + | 1335–1355 |
VP5-DIVA-P1 | 5′ FAM- ACTACAGCTGGTGCATAAC 3′ MGB | + | 1426–1444 |
VP5-DIVA-P2-vac | 5′ FAM- TTTACAGTTGGTTCATAAT 3′ MGB | + | 1426–1444 |
VP5-DIVA-R | 5′ AAGCGCGTTCATTATCGTCC 3′ | – | 1494–1513 |
*Position numbering is with reference to AHSV-1 (GenBank accession no. KT030334). AHSV, African horse sickness virus; DIVA, Differentiating Infected from Vaccinated Animals.
Page created: October 28, 2022
Page updated: November 21, 2022
Page reviewed: November 21, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.