Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 28, Number 2—February 2022

Research

Genetic Relatedness of Infectious Hypodermal and Hematopoietic Necrosis Virus Isolates, United States, 2019

Arun K. DharComments to Author , Roberto Cruz-Flores, Janet Warg, Mary L. Killian, Andrew Orry, Jorge Ramos, Michelle Garfias, and Gregory Lyons
Author affiliations: The University of Arizona, Tucson, Arizona, USA (A.K. Dhar, R. Cruz-Flores, J. Ramos, M. Garfias, G. Lyons); US Department of Agriculture National Veterinary Services Laboratories, Ames, Iowa, USA (J. Warg, M.L. Killian); Molsoft, Inc., San Diego, California, USA (A. Orry)

Main Article

Table 1

Primers used for the detection of the IHHNV genome in commercially raised Penaeus vannamei shrimp, Texas and Florida, United States, 2019*

Target gene Primer name Sequence, 5′ → 3′ Amplicon size, bp Reference
NS1 389F CGGAACACAACCCGACTTTA 389 (13)
NS1 389R GGCCAAGACCAAAATACGAA
NS1 IHHNV-309F TCCAACACTTAGTCAAAACCAA 309 (13)
NS1 IHHNV-309R TGTCTGCTACGATGATTATCCA
NS1 (Left) 159_IH_NS1_S AACTGACGAGTGAAGAGGCT 1295 This study
NS1 (Left) 1446_IH_NS1_AS GTGTCCGGAGTATGTGATGT This study
NS1 (Right) 1400_IH_NS1_S GGACGAACGCCAAACTTCAC 1313 This study
NS1 (Right) 2698_IH_NS1_AS ATCTGTGTGGGTCTGGTCC This study
CP CP1F GATCACCAGCACGACTTCCT 1088 (21)
CP CP2R CGGGTATATATTGCACATCGAA

*CP, capsid protein gene; IHHNV, infectious hypodermal and hematopoietic necrosis virus; NS1, nonstructural gene 1.

Main Article

References
  1. Tijssen  P, Agbandje-McKenna  M, Almendral  J, Bergoin  M, Flegel  T, Hedman  K, et al. Parvoviridae. In: Murphy FA, Fauquet C, Bishop D, editors. Virus taxonomy: ninth report of the international committee on taxonomy of viruses. Amsterdam: Elsevier; 2012. p. 405–25.
  2. Pénzes  JJ, Pham  HT, Chipman  P, Bhattacharya  N, McKenna  R, Agbandje-McKenna  M, et al. Molecular biology and structure of a novel penaeid shrimp densovirus elucidate convergent parvoviral host capsid evolution. Proc Natl Acad Sci U S A. 2020;117:20211–22. DOIPubMedGoogle Scholar
  3. Shike  H, Dhar  AK, Burns  JC, Shimizu  C, Jousset  FX, Klimpel  KR, et al. Infectious hypodermal and hematopoietic necrosis virus of shrimp is related to mosquito brevidensoviruses. Virology. 2000;277:167–77. DOIPubMedGoogle Scholar
  4. Dhar  AK, Robles-Sikisaka  R, Saksmerprome  V, Lakshman  DK. Biology, genome organization, and evolution of parvoviruses in marine shrimp. In: Advances in virus research, 1st ed. Amsterdam: Elsevier Inc.; 2014. p. 85–139.
  5. Lightner  DV, Redman  RM, Bell  T, Brock  J. Detection of IHHN virus in Penaeys stylirostris and P. vannamei imported into Hawaii. J World Maric Soc. 1983;225:212–25.
  6. Bell  TA, Lightner  DV. IHHN virus: Infectivity and pathogenicity studies in Penaeus stylirostris and Penaeus vannamei. Aquaculture. 1984;38:185–94. DOIGoogle Scholar
  7. Dhar  AK, Cruz-Flores  R, Caro  LFA, Siewiora  HM, Jory  D. Diversity of single-stranded DNA containing viruses in shrimp. Virusdisease. 2019;30:43–57. DOIPubMedGoogle Scholar
  8. Flegel  TW. Detection of major penaeid shrimp viruses in Asia, a historical perspective with emphasis on Thailand. Aquaculture. 2006;258:1–33. DOIGoogle Scholar
  9. Sellars  MJ, Cowley  JA, Musson  D, Rao  M, Menzies  ML, Coman  GJ, et al. Reduced growth performance of black tiger shrimp (Penaeus monodon) infected with infectious hypodermal and hematopoietic necrosis virus. Aquaculture. 2019;499:160–6. DOIGoogle Scholar
  10. Centre for Environment Fisheries and Aquaculture Science. International database on aquatic animal disease: infectious hypodermal and haematopoietic necrosis, United Kingdom [Immediate notification 20/08/19]. 2019 [cited 2021 Jul 11]. https://www.cefas.co.uk/international-database-on-aquatic-animal-diseases/abstract/?id=1938
  11. Tang  KFJ, Lightner  DV. Infectious hypodermal and hematopoietic necrosis virus (IHHNV)-related sequences in the genome of the black tiger prawn Penaeus monodon from Africa and Australia. Virus Res. 2006;118:185–91. DOIPubMedGoogle Scholar
  12. Tang  KFJ, Navarro  SA, Lightner  DV. PCR assay for discriminating between infectious hypodermal and hematopoietic necrosis virus (IHHNV) and virus-related sequences in the genome of Penaeus monodon. Dis Aquat Organ. 2007;74:165–70. DOIPubMedGoogle Scholar
  13. Durand  SV, Lightner  DV. Quantitative real time PCR for the measurement of white spot syndrome virus in shrimp. J Fish Dis. 2002;25:381–9. DOIGoogle Scholar
  14. Aranguren  LF, Tang  KFJ, Lightner  DV. Quantification of the bacterial agent of necrotizing hepatopancreatitis (NHP-B) by real-time PCR and comparison of survival and NHP load of two shrimp populations. Aquaculture. 2010;307:187–92. DOIGoogle Scholar
  15. Tang  KFJ, Pantoja  CR, Redman  RM, Han  JE, Tran  LH, Lightner  DV. Development of in situ hybridization and PCR assays for the detection of Enterocytozoon hepatopenaei (EHP), a microsporidian parasite infecting penaeid shrimp. J Invertebr Pathol. 2015;130:37–41. DOIPubMedGoogle Scholar
  16. Han  JE, Tang  KF, Tran  LH, Lightner  DV. Photorhabdus insect-related (Pir) toxin-like genes in a plasmid of Vibrio parahaemolyticus, the causative agent of acute hepatopancreatic necrosis disease (AHPND) of shrimp. Dis Aquat Organ. 2015;113:33–40. DOIPubMedGoogle Scholar
  17. Aranguren  LF, Tang  KFJ, Lightner  DV. Protection from yellow head virus (YHV) infection in Penaeus vannamei pre-infected with Taura syndrome virus (TSV). Dis Aquat Organ. 2012;98:185–92. DOIPubMedGoogle Scholar
  18. Tang  KFJ, Wang  J, Lightner  DV. Quantitation of Taura syndrome virus by real-time RT-PCR with a TaqMan assay. J Virol Methods. 2004;115:109–14. DOIPubMedGoogle Scholar
  19. Andrade  TPD, Srisuvan  T, Tang  KFJ, Lightner  DV. Real-time reverse transcription polymerase chain reaction assay using TaqMan probe for detection and quantification of infectious myonecrosis virus (IMNV). Aquaculture. 2007;264:9–15. DOIGoogle Scholar
  20. Robles-Sikisaka  R, Bohonak  AJ, McClenaghan  LR Jr, Dhar  AK. Genetic signature of rapid IHHNV (infectious hypodermal and hematopoietic necrosis virus) expansion in wild Penaeus shrimp populations. PLoS One. 2010;5:e11799. DOIPubMedGoogle Scholar
  21. Kearse  M, Moir  R, Wilson  A, Stones-Havas  S, Cheung  M, Sturrock  S, et al. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9. DOIPubMedGoogle Scholar
  22. Altschul  SF, Gish  W, Miller  W, Myers  EW, Lipman  DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10. DOIPubMedGoogle Scholar
  23. Tamura  K, Nei  M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993;10:512–26.PubMedGoogle Scholar
  24. Kumar  S, Stecher  G, Tamura  K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–4. DOIPubMedGoogle Scholar
  25. Kaufmann  B, Bowman  VD, Li  Y, Szelei  J, Waddell  PJ, Tijssen  P, et al. Structure of Penaeus stylirostris densovirus, a shrimp pathogen. J Virol. 2010;84:11289–96. DOIPubMedGoogle Scholar
  26. Nunan  LM, Poulos  BT, Lightner  DV. Use of polymerase chain reaction for the detection of infectious hypodermal and hematopoietic necrosis virus in Penaeid shrimp. Mar Biotechnol (NY). 2000;2:319–28. DOIPubMedGoogle Scholar
  27. Saksmerprome  V, Jitrakorn  S, Chayaburakul  K, Laiphrom  S, Boonsua  K, Flegel  TW. Additional random, single to multiple genome fragments of Penaeus stylirostris densovirus in the giant tiger shrimp genome have implications for viral disease diagnosis. Virus Res. 2011;160:180–90. DOIPubMedGoogle Scholar
  28. World Organisation for Animal Health (OIE). Infection with infectious hypodermal and haematopoietic necrosis virus. In: Manual of diagnostic tests for aquatic animals, 4th ed. Paris, France: Office International des Epizooties; 2017. p. 1–18.
  29. Senapin  S, Phewsaiya  K, Briggs  M, Flegel  TW. Outbreaks of infectious myonecrosis virus (IMNV) in Indonesia confirmed by genome sequencing and use of an alternative RT-PCR detection method. Aquaculture. 2007;266:32–8. DOIGoogle Scholar
  30. Dhar  AK, Lakshman  DK, Amundsen  K, Robles-Sikisaka  R, Kaizer  KN, Roy  S, et al. Characterization of a Taura syndrome virus isolate originating from the 2004 Texas epizootic in cultured shrimp. Arch Virol. 2010;155:315–27. DOIPubMedGoogle Scholar
  31. Chaijarasphong  T, Thammachai  T, Itsathitphaisarn  O, Sritunyalucksana  K, Suebsing  R. Potential application of CRISPR-Cas12a fluorescence assay coupled with rapid nucleic acid amplification for detection of white spot syndrome virus in shrimp. Aquaculture. 2019;512:734340. DOIGoogle Scholar
  32. Sullivan  TJ, Dhar  AK, Cruz-Flores  R, Bodnar  AG. Rapid, CRISPR-based, field-deployable detection of white spot syndrome virus in shrimp. Sci Rep. 2019;9:19702. DOIPubMedGoogle Scholar
  33. Lightner  V. Biosecurity in shrimp farming: pathogen exclusion through use of SPF stock and routine surveillance. J World Aquacult Soc. 2005;36:230–48. DOIGoogle Scholar

Main Article

Page created: December 08, 2021
Page updated: January 24, 2022
Page reviewed: January 24, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external