Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Disclaimer: Early release articles are not considered as final versions. Any changes will be reflected in the online version in the month the article is officially released.

Volume 32, Number 5—May 2026

Synopsis

Three Fatal Gestational Psittacosis Cases Caused by Chlamydia psittaci Strains Belonging to Closely Related Lineages, Japan

Atsuko Nishino, Yukiko Nakura, Yukiko Sassa-O’Brien, Momoko Soeda, Hirokazu Sugii, Kanako Shimizu, Shiro Miura, Yumiko Sato, Michinobu Yoshimura1, Michiko Kodama, and Itaru YanagiharaComments to Author 
Author affiliation: Research Institute, Osaka Women’s and Children’s Hospital, Osaka, Japan (A. Nishino, Y. Nakura, M. Yoshimura, I. Yanagihara); The University of Osaka, Osaka, Japan (A. Nishino, M. Kodama, I. Yanagihara); Tokyo University of Agriculture and Technology, Tokyo, Japan (Y. Sassa-O’Brien); NHO Nagasaki Medical Center, Nagasaki, Japan (M. Soeda, S. Miura); NHO Iwakuni Clinical Center, Yamaguchi, Japan (H. Sugii, Y. Sato); Tannan Health Welfare Center, Fukui, Japan (K. Shimizu); Maizuru Kyosai Hospital, Kyoto, Japan (K. Shimizu)

Main Article

Table 1

Primers and probes used for diagnosing Chlamydia psittaci and MLST in study of 3 fatal gestational psittacosis cases caused by C. psittaci strains belonging to closely related MLST lineages, Japan, 2017–2024*

Method Target gene Primer or probe Sequence, 5′→3′ Amplicon size, bp Reference
Real-time PCR
 16S–23S rRNA operon
 CPSI_F AAGGAGAGAGGCGCCCAA 133
 (21)
CPSI_R
 CAACCTAGTCAAACCGTCCTAA
C. psittaci PCR 16S rRNA C.p.16S 45F TGGATGAGGCATGCAAGTCG 276 This study
C.p.16S 320R TGGCGGTCAATCTCTCAATC
C.p.16S 1172F GGGTTAACCAGGAGGAAGGC 199
 This study
C.p.16S 1370R
 AGCTGACACGCCATTACTAGC
MLST PCR
 enoA YPenoA3 CCTATGATGAATCTCATTAATGG 428 (22); this study†
YPenoA4 CCCAACCATCAAAATCTTCTTCCG
fumC YPfumC1 GGGCTCCTGAGGTTATGCC 649
YPfumC2 CGCAAATAATGAATCACCTTATC
gatA YPgatA3 GCCTTAGAGTTAAGAAATGCCG 509
YPgatA4 CCCCCTGTATCGGAACCTAACGC
gidA YPgidA1 GCTTATTAGAGAGCTGTCCTGGC 693
YPgidA2 CGCGTTTTCTAACCCACGG
hemN YPhemN1 GGATCCATTTCGGAGGAGGC 398
hemN-R2† TAAGCGGTCAGGCCGCATGTG
hemN-F2† GTCAAAGTCATGAAGAGTCAC 505
YPhemN2 CCTGAAAGGATTTTCTCATGG
hflX YPhflX3 GAGATTTTTGCTAATCGAGCG 530
YPhflX4 GTAAAACATCTTCATGTAACGC
oppA
 YPoppA3 ATGCGCAAGATATCAATGGG 500–610
YPoppA4
 GGCAAGGTTTGGTGTAACTCGC
PCR ompA CPsittGenoFor GCTACGGGTTCCGCTCT FO-01: 625; YO-02: 631; NO-03: 622 (23); this study†
Cp ompA R3 † CAATYTTAGGATTAGATTGAGC
Cp ompA F3 † TGGGATCGCTYCGAYATTTTC FO-01: 495; YO-02: 508; NO-03: 498
Cp ompA R4 † TGCTCTTGACCAGTTTACGCC
Cp ompA F4 † TATGGGAATGTGGTTGTGCAA FO-01: 452; YO-02: 452; NO-03: 451
CPsittGenoRev TTTGTTGATYTGAATCGAAGC

*MLST, multilocus sequence typing.

Main Article

References
  1. Tantengco  OAG. Gestational psittacosis: an emerging infection. Lancet Microbe. 2022;3:e728. DOIPubMedGoogle Scholar
  2. Hogerwerf  L. DE Gier B, Baan B, VAN DER Hoek W. Chlamydia psittaci (psittacosis) as a cause of community-acquired pneumonia: a systematic review and meta-analysis. Epidemiol Infect. 2017;145:3096–105. DOIPubMedGoogle Scholar
  3. Wang  W, Sung  N, Gilman-Sachs  A, Kwak-Kim  J. T helper (Th) cell profiles in pregnancy and recurrent pregnancy losses: Th1/Th2/Th9/Th17/Th22/Tfh cells. Front Immunol. 2020;11:2025. DOIPubMedGoogle Scholar
  4. Baud  D, Greub  G. Intracellular bacteria and adverse pregnancy outcomes. Clin Microbiol Infect. 2011;17:1312–22. DOIPubMedGoogle Scholar
  5. Katsura  D, Tsuji  S, Kimura  F, Tanaka  T, Eguchi  Y, Murakami  T. Gestational psittacosis: a case report and literature review. J Obstet Gynaecol Res. 2020;46:673–7. DOIPubMedGoogle Scholar
  6. Kozuki  E, Arima  Y, Matsui  T, Sanada  Y, Ando  S, Sunagawa  T, et al. Human psittacosis in Japan: notification trends and differences in infection source and age distribution by gender, 2007 to 2016. Ann Epidemiol. 2020;44:60–3. DOIPubMedGoogle Scholar
  7. Stokes  HS, Berg  ML, Bennett  ATD. A review of chlamydial infections in wild birds. Pathogens. 2021;10:948. DOIPubMedGoogle Scholar
  8. Fukushi  H, Itoh  K, Ogawa  Y, Hayashi  Y, Kuzuya  M, Hirai  K, et al. Isolation and serological survey of Chlamydia psittaci in feral pigeons from Japan. Nippon Juigaku Zasshi. 1983;45:847–8. DOIPubMedGoogle Scholar
  9. Tanaka  C, Miyazawa  T, Watarai  M, Ishiguro  N. Bacteriological survey of feces from feral pigeons in Japan. J Vet Med Sci. 2005;67:951–3. DOIPubMedGoogle Scholar
  10. Sassa-O’Brien  Y, Wu  CF, Matsunaga  S, Ohya  K, Fukushi  H. Isolation of “pigeon-type” Chlamydia psittaci and detection of Chlamydia-related bacteria in Indian ring-necked parakeets (Psittacula krameri manillensis) in introduced flocks in urban area of Japan. Vet Microbiol. 2025;309:110689. DOIPubMedGoogle Scholar
  11. Rehn  M, Ringberg  H, Runehagen  A, Herrmann  B, Olsen  B, Petersson  AC, et al. Unusual increase of psittacosis in southern Sweden linked to wild bird exposure, January to April 2013. Euro Surveill. 2013;18:20478. DOIPubMedGoogle Scholar
  12. Chereau  F, Rehn  M, Pini  A, Kühlmann-Berenzon  S, Ydring  E, Ringberg  H, et al. Wild and domestic bird faeces likely source of psittacosis transmission—a case-control study in Sweden, 2014–2016. Zoonoses Public Health. 2018;65:790–7. DOIPubMedGoogle Scholar
  13. World Health Organization. Psittacosis—European Region [cited 2026 Mar 25]. https://www.who.int/emergencies/disease-outbreak-news/item/2024-DON509
  14. Zhang  Z, Zhou  H, Cao  H, Ji  J, Zhang  R, Li  W, et al. Human-to-human transmission of Chlamydia psittaci in China, 2020: an epidemiological and aetiological investigation. Lancet Microbe. 2022;3:e512–20. DOIPubMedGoogle Scholar
  15. Jelocnik  M, Jenkins  C, O’Rourke  B, Barnwell  J, Polkinghorne  A. Molecular evidence to suggest pigeon-type Chlamydia psittaci in association with an equine foal loss. Transbound Emerg Dis. 2018;65:911–5. DOIPubMedGoogle Scholar
  16. Fukushi  H. Chlamydiosis in zoo [in Japanese]. Jpn J Zoo Wildl Med. 2003;8:11–7.
  17. Shimizu  K, Nishijima  K, Kawahara  K, Banno  Y, Yoshimura  M, Yanagihara  I, et al. The first case of maternal death due to psittacosis [in Japanese]. Obstetrical and Gynecological Practice. 2018;67:445–50.
  18. Yoshimura  M, Shimizu  K, Nakura  Y, Kawahara  K, Katano  H, Motooka  D, et al. A fatal case of hemophagocytic lymphohistiocytosis associated with gestational psittacosis without symptoms of pneumonia. J Obstet Gynaecol Res. 2022;48:3325–30. DOIPubMedGoogle Scholar
  19. Tanioka  M, Sugii  H, Kanemori  M, Ito  H. Gestational psittacosis: a case report and literature review [in Japanese]. Modern Trends in Obstetrics & Gynecology. 2023;72:215–20.
  20. Miyauchi  T, Hirata  Y, Fukuda  S. Postmortem diagnosis of gestational psittacosis: A case report. Acute Med Surg. 2024;11:e932. DOIPubMedGoogle Scholar
  21. Opota  O, Jaton  K, Branley  J, Vanrompay  D, Erard  V, Borel  N, et al. Improving the molecular diagnosis of Chlamydia psittaci and Chlamydia abortus infection with a species-specific duplex real-time PCR. J Med Microbiol. 2015;64:1174–85. DOIPubMedGoogle Scholar
  22. Pannekoek  Y, Dickx  V, Beeckman  DS, Jolley  KA, Keijzers  WC, Vretou  E, et al. Multi locus sequence typing of Chlamydia reveals an association between Chlamydia psittaci genotypes and host species. PLoS One. 2010;5:e14179. DOIPubMedGoogle Scholar
  23. Heddema  ER, Ter Sluis  S, Buys  JA, Vandenbroucke-Grauls  CM, van Wijnen  JH, Visser  CE. Prevalence of Chlamydophila psittaci in fecal droppings from feral pigeons in Amsterdam, The Netherlands. Appl Environ Microbiol. 2006;72:4423–5. DOIPubMedGoogle Scholar
  24. Zhou  Z, Alikhan  NF, Sergeant  MJ, Luhmann  N, Vaz  C, Francisco  AP, et al. GrapeTree: visualization of core genomic relationships among 100,000 bacterial pathogens. Genome Res. 2018;28:1395–404. DOIPubMedGoogle Scholar
  25. Katoh  K, Rozewicki  J, Yamada  KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2019;20:1160–6. DOIPubMedGoogle Scholar
  26. Page  AJ, Taylor  B, Delaney  AJ, Soares  J, Seemann  T, Keane  JA, et al. SNP-sites: rapid efficient extraction of SNPs from multi-FASTA alignments. Microb Genom. 2016;2:e000056. DOIPubMedGoogle Scholar
  27. Wang  J, Wang  B, Xiao  J, Chen  Y, Wang  C. Chlamydia psittaci: a zoonotic pathogen causing avian chlamydiosis and psittacosis. Virulence. 2024;15:2428411. DOIPubMedGoogle Scholar
  28. Capella-Gutiérrez  S, Silla-Martínez  JM, Gabaldón  T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25:1972–3. DOIPubMedGoogle Scholar
  29. Steenwyk  JL, Buida  TJ III, Li  Y, Shen  XX, Rokas  A. ClipKIT: a multiple sequence alignment trimming software for accurate phylogenomic inference. PLoS Biol. 2020;18:e3001007. DOIPubMedGoogle Scholar
  30. Letunic  I, Bork  P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024;52(W1):W78–82. DOIPubMedGoogle Scholar
  31. Nakajyo  A, Sotome  Y, Matsuyama  T, Yoshioka  M, Karube  M, Matsubara  H. A case of a female infant born from a pregnant woman who contracted psittacosis in late pregnancy [in Japanese]. J Pediatr. 2002;55:895–8.
  32. Hattori  A, Yoshida  A, Oku  K, Kamiya  A, Kuroda  Y, Kasamatsu  A, et al. Gestational psittacosis of the placenta with massive perivillous fibrin deposition leading to intrauterine fetal demise: a case report [in Japanese]. Journal Japan Society of Perinatal and Neonatal Medicine. 2021;57:140–5.
  33. Mitsuzuka  K, Manabe  T, Sakamoto  N, Nakajima  R, Kashiwagi  H, Hayashi  M, et al. A case of gestational psittacosis presenting with pneumonia similar to COVID-19 and disseminated intravascular coagulation [in Japanese]. In: Abstracts of the 58th Annual Congress of Japan Society of Perinatal and Neonatal Medicine; Kanagawa, Japan; 2022 Jul 10–12. Abstract O-015. Tokyo: Journal of Japan Society of Perinatal and Neonatal Medicine; 2022.
  34. Huang  W, Hu  S, Zhu  Y, Liu  S, Zhou  X, Fang  Y, et al. Metagenomic surveillance and comparative genomic analysis of Chlamydia psittaci in patients with pneumonia. Front Microbiol. 2023;14:1157888. DOIPubMedGoogle Scholar
  35. Everett  KD, Bush  RM, Andersen  AA. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. Int J Syst Bacteriol. 1999;49:415–40. DOIPubMedGoogle Scholar
  36. Yang  Z, Wang  S, Xing  D, Zhang  H. Pregnancy combined with severe pneumonia caused by Chlamydia psittaci infection—a case report. Ginekol Pol. 2021;92:743–4. DOIPubMedGoogle Scholar
  37. Sun  L, Li  P, Pang  B, Wu  P, Wang  R. Gestational psittacosis with secondary hemophagocytic syndrome: a case report and literature review. Front Med (Lausanne). 2021;8:755669. DOIPubMedGoogle Scholar
  38. Wang  L, Lin  C, Qi  Y. Gestational psittacosis causes severe pneumonia and miscarriage: a case report and literature review. Radiol Case Rep. 2023;18:1959–62. DOIPubMedGoogle Scholar
  39. Liu  Z, Luo  L, Zhang  Z, Li  X, Zuo  B, Wu  D. Epidemiological investigation and clinical presentation of severe gestational psittacosis diagnosed using targeted next-generation sequencing: a case report. Medicine (Baltimore). 2025;104:e46860. DOIPubMedGoogle Scholar
  40. Janssen  MJ, van de Wetering  K, Arabin  B. Sepsis due to gestational psittacosis: a multidisciplinary approach within a perinatological center—review of reported cases. Int J Fertil Womens Med. 2006;51:17–20.PubMedGoogle Scholar
  41. Imkamp  F, Albini  S, Karbach  M, Kimmich  N, Spinelli  C, Herren  S, et al. Zoonotic Chlamydiae as rare causes of severe pneumonia. Swiss Med Wkly. 2022;152:w30102. DOIPubMedGoogle Scholar
  42. Guscoth  LB, Taylor  DM, Coad  F. Persistent renal replacement requirement following fulminant psittacosis infection in pregnancy. BMJ Case Rep. 2022;15:e250221. DOIPubMedGoogle Scholar
  43. Paul  L, Comstock  J, Edes  K, Schlaberg  R. Gestational psittacosis resulting in neonatal death identified by next-generation RNA sequencing of postmortem, formalin-fixed lung tissue. Open Forum Infect Dis. 2018;5:ofy172. DOIPubMedGoogle Scholar
  44. Herrmann  B, Aaziz  R, Kaden  R, Riedel  HM, Spörndly-Nees  E, Sandelin  LL, et al. SNP-based high-resolution typing of Chlamydia psittaci from humans and wild birds in Sweden: circulation of the Mat116 genotype reveals the transmission mode to humans. Microbes Infect. 2024;26:105251. DOIPubMedGoogle Scholar
  45. Creisher  PS, Klein  SL. Pathogenesis of viral infections during pregnancy. Clin Microbiol Rev. 2024;37:e0007323. DOIPubMedGoogle Scholar
  46. Fournier  SB, D’Errico  JN, Stapleton  PA. Uterine vascular control preconception and during pregnancy. Compr Physiol. 2021;11:1871–93. DOIPubMedGoogle Scholar
  47. Wallace  JM, Bhattacharya  S, Horgan  GW. Gestational age, gender and parity specific centile charts for placental weight for singleton deliveries in Aberdeen, UK. Placenta. 2013;34:269–74. DOIPubMedGoogle Scholar

Main Article

1Current affiliation: Fukuoka University, Fukuoka, Japan.

Page created: April 01, 2026
Page updated: April 16, 2026
Page reviewed: April 16, 2026
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external