Figure 1

Figure 1. Comparison of the relative developmental success of 11 different isolates of Plasmodium vivax in Anopheles albimanus and An. freeborni. The black bars and arrows represent An. albimanus, and the grey bars...

We examined the transmissibility of different isolates of P. vivax and found that they vary in a selective way. The comparative feeding results from the study of 10 individual strains of P. vivax are shown (Figure 1). For all parasite strains collected from the New World infected mosquitoes (as measured by oocyst count), the average infection rate was 30.6% for a single line of Central American An. albimanus and 51.9% for a laboratory line of An. freeborni, the positive control. The Old World parasite strains, on the other hand, had an average infection rate of only 0.25% for An. albimanus, while infecting the positive control, An. Freeborni, quite normally at 63.4%. Methods and preliminary data on the correlation between different mosquito colonies and parasite development in An. culicifacies have been reported (5).

Further experiments tested the effect of the origin of An. albimanus on transmissibility of P. vivax. Five New World An. albimanus colonies were far more susceptible to each New World parasite than to any Old World parasite line (Table). The average infection rate for five different New World colonies was 21.2%. As the positive control, An. freeborni was infected by parasites from the different areas with a mean infection rate of 57.1%. Hence, the distinction of developmental success in An. albimanus did not relate to characteristics of a single colony but was a more general phenomenon. The single exception to the Old World-New World separation was P. simium, a New World monkey parasite morphologically similar to P. vivax, which has been reported to successfully infect An. freeborni but not to be very infective to An. albimanus (6).

Consistent Differences Between Old and New World Isolates of P. vivax in S-type rRNA Genes: Result of a Single-Type Gene Conversion

Figure 2

Figure 2. Sequences of Plasmodium vivax isolates are distinguished by variation in the 3' end of the S-type rRNA gene (10). The S-type gene is longer in Old World isolates and...

DNA sequence analysis of the cloned 18S rRNA genes from 17 isolates, including 5 of 7 Old World isolates and 5 of 7 New World isolates from infectivity studies, indicated that all strains shared similar sequence types, including 3 types of genomic rRNA genes as we described for the Sal-1 strain (7,8). In comparing the 18S rRNA sequences of New World and Old World isolates, however, we found a consistent polymorphism that separated the two according to geographic location (Figure 2). While the genes expressed in blood stage (A type) and oocysts (O type) remained the same in all isolates, the S-type genes transcribed in sporozoites were maintained in either one or the other of two distinct forms (Figure 2). The New World type of S gene has been reported in a P. vivax isolate from El Salvador (12), and the Old World type has been reported to exist in the monkey malaria, P. simium (13; Li and McCutchan, unpub. data). The difference between the two types of S gene is localized at the 3' end of the gene, including the last variable region, V8 (10). The A gene and two types of the S genes were differentiated on the basis of fragment length (Figure 2). The assignment of type was confirmed in all isolates by DNA sequence analysis. The results indicate that one type of S gene is shared by all strains or isolates from Central and South America. Parasites from Asia, the Pacific region, and Africa have a genotype similar to the S gene from the primate malaria P. cynomolgi and exactly like that of P. simium.

Figure 3

Figure 3. The sequence of Plasmodium vivax from the Americas is distinguished from Old World isolates by analysis of the 3' end of the S-type rRNA gene. The S-type rRNA sequences were determined...

The structure of the variant New World S gene appeared to be the result of a simple conversion between the A and S genes (Figure 3). Further, the point of conversion between A and S genes appeared to be the same (within 9 bp) in all New World isolates. The simplest conclusion is that only one conversion occurred, and it existed in the progenitor of all New World strains thus far examined. Expression of the two types of S gene has been confirmed by sequencing of cloned reverse transcriptase/polymerase chain reaction fragments amplified from sporozoite rRNA (Li and McCutchan, data not shown).

Analysis of the Open Reading Frame (ORF) 470 in P. vivax Consistent with Parasite Associations Established with Genomic Markers

Figure 4

Figure 4. Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273...

This 35-kb circular DNA is maternally inherited and highly conserved in sequence (14). We investigated the ORF 470, the small subunit rRNA, and the Clp gene for phylogenetically informative sites. The results show that a conserved substitution of the ORF 470 has been maintained among the New World P. vivax, where an isoleucine is replaced by valine. The parasites from Old World isolates maintain the isoleucine, as do their putative progenitors from primate malarias (Figure 4). The limited number of maternal types is not unexpected because of the extensive plastid homogeneity found within species of these parasites (14). We assume that this polymorphism is representative of two separate lineages.

The evolution of a new species or subspecies from within the range of a single sexually reproducing population has been of central interest to biologists since before Darwin. With regard to medicine and epidemiology, an understanding of the above would substantially contribute to designing procedures for pathogen control (15). We have shown that a partition subdivides the population range of P. vivax and have presented one reason why such partitions remain stably in place.

The epidemiologic impact of barriers to genetic exchange is substantial. Such barriers can come from both geologic and biologic sources. We have shown that differing vector-parasite compatibility can create genetic isolation between populations of a single parasite species. In principle, the question of differing vector-parasite compatibility has been addressed by the observation of historic events. When millions of potentially exposed soldiers returned home from World War II, Korea, and Vietnam, reintroduction of malaria was considered a serious possibility, given that P. vivax was only eliminated from the United States in the 1940s and the vectors were still in abundance. The fact that P. vivax was not reintroduced was, at the time, surprising. How could the parasites from Asia and America be different? Because P. vivax collected from the New World, Africa, and Asia have indistinguishable morphologic features and life cycles, as well as many of the same surface antigens, it was assumed that they represented the same parasite.

A dichotomy is revealed when one compares the relative developmental success of different parasite isolates in An. albimanus and An. freeborni. Both mosquitoes come from the Americas, but An. albimanus is indigenous to malarious areas and An. freeborni is not. When different isolates of P. vivax were fed to the New World mosquitoes, an obvious division formed along broad geographic lines. An. albimanus were more easily infected by New World parasites than by Old World parasites, whereas no difference in infectivity was detected in the control, An. freeborni. Hence, adaptation to the mosquito, rather than general developmental fitness, is the selective basis for separation. Examination of An. albimanus from five different areas of the New World each revealed the dichotomy. It is of interest that the insect-parasite association developed along broad geographic lines.

More than 25,000 mosquitoes were dissected during a 10-year period, and the resultant large numbers have implications for the interpretation of results. Clearly, the feedings were repeated many times, and each can be considered a separate experiment. The same protocol was followed in each experiment, but slight variations in factors such as the exact age of the mosquitoes and the source of infective blood must have occurred during the study period. The simple conclusion that a large difference exists in the developmental success of parasites from the Old and New Worlds in An. albimanus was entirely consistent over the period, and all experiments are in accord with that conclusion. Development of the same parasite strains was also tested in an Old World mosquito, An. culicifacies (Collins et al., unpub. data). As a group, Old World parasites infected An. culicifacies more efficiently and had a higher rate of oocyst production than parasites from the New World, although some New World parasite lines had not lost the potential to infect An. culicifacies. This indicates that while the lineage giving rise to New World parasites may have developed successfully in An. culicifacies and other Old World mosquitoes, that potential may be lost during the process of adapting to a new environment.

The developmental mechanism involved in determining success of a parasite isolate in mosquito colonies represents an unknown number of loci. Data supporting the division defined by infectivity studies were based on DNA polymorphisms in samples supplied from the American Type Culture Collection (Rockville, MD) and the Centers for Disease Control and Prevention's Parasitology Branch. The episomal marker is located within the ORF 470 of the 35-kb plastid (11), which is physically unlinked to genomic markers. Our genomic marker is a polymorphism resulting from a defined ribosomal RNA gene transformation. Although we cannot definitively say that the division of groups is related to their genetic isolation (i.e., we cannot show that we have saturated the genome with markers), that does appear to be the case. The premise of our interpretation is that episomal and chromosomal ribosomal markers are not linked to each other and are unlikely to be linked to genes controlling parasite development in the mosquito.

P. simium carries genomic and maternal polymorphisms identical to the Old World human parasite P. vivax. Its ancestors are certainly more maternally related to the Old World P. vivax of humans than to the P. vivax that now dominates humans in South America. Thus, a lateral transfer occurred during P. simium evolution, as previously indicated (13,16,17). P. simium and New World P. vivax did not originate directly from the same source, contrary to published speculation on the parasite's evolution. Therefore, P. vivax most likely entered the New World on two separate occasions and from different geographic locations.

Two types of repetitive epitope have been described in the circumsporozoite protein gene of P. vivax; their distribution appears to be worldwide (18). We confirm this finding in our isolates (data not shown); hence, all our isolates arose from a common ancestor. The separation of these two P. vivax subspecies may have started before entry into the Americas, but it is likely that isolation and adaptation to the new environment were strong forces in driving the fixation of the parasites that now exist there. It is widely, although not universally, agreed that P. vivax entered into the Americas within the last 500 years. If true, this would suggest that fixation and dispersal over a wide geographic area happened within a few hundred years. Although this seems rapid, it is within the realm of what we know about malaria. The period of isolation needed for subspecific differentiation can occur in less than 300 generations. In a natural system involving Plasmodium, this could happen in as few as 60 years (19). Speculation with regard to the evolution of malaria parasites of neotropical monkeys suggests that altered selective pressures on an isolated group of mammalian malaria parasites may lead to the evolution of a new species in only a few hundred years. The time of genetic separation needed to form new species is thus generously provided within the above range.

P. vivax of the New World clearly has distinctive features that relate to its potential for spread and thus require taxonomic distinction. Justifications for the designation of subspecies are met ⁽1⁾; phenotypic differences exist among parasites that occupy different sectors of the inclusive geographic range of P. vivax. There are subspecies of Old World P. vivax separated on the basis of biologic characteristics: relapse pattern (e.g., P. vivax hibernans and P. vivax multinucleatum), and morphologic characteristics such as multiple-cell invasion (20). It follows that if these were sympatric, interbreeding would have led to the loss of identity (2). The question is whether species classification is justified for the New World parasite. Historically, a major branching occurred in the P. vivax species, or species complex, which divided the New World P. vivax from known Old World parasites. The problem with either designation (species ⁽2⁾ or subspecies) is that it is unclear how many other taxonomic distinctions are warranted within the New World. For example, a study in Mexico links a polymorphism within the circumsporozoite protein gene with transmission and geographic distribution (21). Although this does not indicate the existence of other restricted gene pools, the circumsporozoite protein gene and transmission being genetically associated, it does show that further subdivisions are present within the New World that are being affected by mosquito distribution. We suggest that the New World parasite be given a subspecies designation, P. vivax collins, until it can be determined whether the New World group can be further subdivided into phenotypically defined groups occupying portions of this parasite's range. The species designation P. collinsi should then be considered.

We thank Margery Sullivan for help in designing the figures and critically reading the manuscript and Nancy Shulman for editorial advice and assistance.