Volume 13, Number 10—October 2007
Dispatch
Foot-and-Mouth Disease Virus Serotype A in Egypt
Table 2
Primer name | Primer sequence (5′→3′) | Sense | Gene | Position† |
---|---|---|---|---|
A-1C562F | TACCAAATTACACACGGGAA | Forward | VP3 | 3123–3142 |
A-1C612F | TAGCGCCGGCAAAGACTTTGA | Forward | VP3 | 3173–3193 |
EUR-2B52R | GACATGTCCTCCTGCATCTGGTTGAT | Reverse | 2B | 3963–3988 |
NK72 | GAAGGGCCCAGGGTTGGACTC | Reverse | 2A/2B | 3897–3917 |
A-1D523R | CGTTTCATRCGCACRAGRA | Reverse | VP1 | 3748–3766 |
*RT-PCR, reverse transcription–PCR.
†Position on the genome of A21/Lumbwa/KEN/64 (GenBank accession no. AY593761).
Page created: July 02, 2010
Page updated: July 02, 2010
Page reviewed: July 02, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.