Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 10, Number 9—September 2004

Research

Genotyping, Orientalis-like Yersinia pestis, and Plague Pandemics

Michel Drancourt*, Véronique Roux*, La Vu Dang*, Lam Tran-Hung*, Dominique Castex†, Viviane Chenal-Francisque‡, Hiroyuki Ogata§, Pierre-Edouard Fournier*, Eric Crubézy¶, and Didier Raoult*Comments to Author 
Author affiliations: *Université de la Méditerranée, Marseille, France; †Université de Bordeaux 1, Talence, France; ‡Institut Pasteur, Paris, France; §Information Génomique et Structurale, Marseille, France; ¶Université Paul Sabatier, Toulouse, France

Main Article

Table 2

Location of primers used for PCR amplification and sequencing of eight intergenic spacers in Yersinia pestisa

Spacer Upstream gene (N)
Downstream gene (N) Primer sequence
(5´ → 3´)
YP1 ace K (YP03724)
ace A (YP03725) AATCCCTGCAAAATGGTCTG
CTGATGGGAAGCAAAGGTGT
YP3 glg P (YP03938)
glg A (YP03939) TCAGTGCATCCACACTGACA
CGTATCGCCTTCACTAAGGC
YP4 gene ID 1176814 (YP03976)
gor (YP03977) TAATCCGCCGTGGAAATTAG
ACGATTATCTGGCAATTGGC
YP5 Gene ID 1175557 (YP02727)
Gene ID 1175558 (YP02728) GCATGCGCTGTTTGATATTG
TTATGACTCACGGACGATGC
YP7 lex A (YP00314)
Gene ID 1173160 (YP00315) GTAACGGGGACTGGATCTGA
ATAAACCGTGTGCTTCCACC
YP8 Gene ID 1175559 (YP02729)
Gene ID 1175560 (YP02730) ACGGAAATTGCCAGATTCA
GACTTGAGCTTCATTTGGCC
YP9 mrd F (YP02648)
mrd E (YP02649) GCGCTGATACGTGTTATTGG
TTGTTAATATCGCGGGTGGTA
YP10 bio D (YP02269)
Gene ID 1175101 (YP02270) ATGCTGAAACAATCGCAATG
CAATAAGGTGTACTCGCCGG

aNumbering according to the Y. pestis CO92 strain genome, GenBank accession no. NC-223143). PCR, polymerase chain reaction.

Main Article

TOP