Volume 11, Number 8—August 2005
Research
Coxiella burnetii Genotyping
Table A2
Primer | Nucleotide sequence 5´ → 3´ | Position in the gene | |
---|---|---|---|
djlA-1*† | CGGTGATGAACTGGATTGG | –5 – 15 | |
djlA-2† | ATTGACCTGACGCGCTTGACG | 266 –247 | |
djlA-3† | GGCAACGCAAGACCCCCGTG | 579 – 598 | |
djlA-4*† | AACCATGCTTCGCACCTTAC | 810 –791 | |
com-1*† | CGTGAAGAACCGTTTGACTG | 3 – 22 | |
com-2† | TGAGGATTGCCTGCCACTGG | 284 – 265 | |
com-3† | GCGCTGCTCAGTGTCGACGG | 490 – 509 | |
com-4*† | CTTTTCTACCCGGTCGATTTC | 759 – 739 | |
Primer | Nucleotide sequence 5´ → 3´ | Position in the plasmid | ORF |
QpH11 | TGACAAATAGAATTTCTTCATTTTGATG | QpH1 (gb:AE016829) 15332 –15359 | Spacer between two hypothetical proteins |
QpH12 | GCTTATTTTCTTCCTCGAATCTATGAAT | QpH1 (gb:AE016829) 168348 – 16375 | Spacer between two hypothetical proteins |
QpRSO1 | CTCGTACCCAAAGACTATGAATATATCC | QpRS gb:Y15898) 14761 –14734 | Hypothetical protein |
QpRS02 | CACATTGGGTATCGTACTGTCCCT | QpRS gb:Y15898) 14398 – 14321 | Hypothetical protein |
QpDV1f | ATGAGAGAAGAGCAGCCGCT | QpRS (gb:Y15898) 9889 – 9908 | Hypothetical protein |
QpDV1r | TCAATGATCCGATGTGCGTTT | QpH1 (gb:Y15898) 10634 –10614 | Hypothetical protein |
*Oligonucleotide primer used for PCR amplification.
†Oligonucleotide primer used for sequencing.
1Dr. Glazunova and Dr. Roux contributed equally to this work.
Page created: April 23, 2012
Page updated: April 23, 2012
Page reviewed: April 23, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.