Volume 20, Number 5—May 2014
Research
Bovine Leukemia Virus DNA in Human Breast Tissue
Table 3
BLV gene | Primer pair sequences, 5′ → 3′† | Location in bp‡ | Nested PCR role | Product length, bp | L-PCR/IS-PCR§ |
|
---|---|---|---|---|---|---|
Annealing temperature, °C | Extension time, s | |||||
LTR | F: TAGGAGCCGCCACCGC | 23–38 | Outer | 329 | 57/53 | 22/120 |
R: GCGGTGGTCTCAGCCGA | 352–336 | |||||
F:AAACTGCAGCGTAAACCAGACAGAGACG | 41–59 | Inner | 290 | 58/57 | 20/120 | |
R: CACCCTCCAAACCGTGCTTG | 331–312 | |||||
gag (p24) | F: AACACTACGACTTGCAATCC | 1068–1087 | Outer | 385 | 54/53 | 28/120 |
R: GGTTCCTTAGGACTCCGTCG | 1453–1434 | |||||
F: ACCCTACTCCGGCTGACCTA | 1097–1116 | Inner | 272 | 56/56 | 24/120 | |
R: CTTGGACGATGGTGGACCAA | 1369–1350 | |||||
pol | F: TAGCCTACGTACATCTAACC | 3238–3257 | Outer | 232 | 52/53 | 22/120 |
R: AATCCAATTGTCTAGAGAGG | 3470–3451 | |||||
F: GGTCCACCCTGGTACTCTTC | 3265–3284 | Inner | 157 | 57/56 | 18/120 | |
R: TATGGGCTTGGCATACGAGC | 3422–3403 | |||||
env | F: TGATTGCGAGCCCCGATG | 5144–5160 | Outer | 264 | 55/53 | 24/120 |
R: TCTGACAGAGGGAACCCAGT | 5408–5389 | |||||
F: TGATTGCGAGCCCCGATG | 5144–5160 | Inner | 230 | 55/56 | 22/120 | |
R: GGAAAGTCGGGTTGAGGG | 5374–5357 | |||||
tax | F: CTTCGGGATCCATTACCTGA | 7197–7216 | Outer | 373 | 55/55 | 26/120 |
R: GCTCGAAGGGGGAAAGTGAA | 7570–7551 | |||||
F: ATGTCACCATCGATGCCTGG | 7310–7329 | Inner 1 | 113 | 55/53 | 15/120 | |
R: CATCGGCGGTCCAGTTGATA | 7423–7404 | |||||
F: GGCCCCACTCTCTACATGC | 7265–7283 | Inner 2 (sequencing) | 206 | 56 | 22 | |
R: AGACATGCAGTCGAGGGAAC | 7471–7452 |
*BLV, bovine leukemia virus; L-PCR, nested liquid-phase PCR; IS-PCR, nested in situ PCR; LTR, long terminal repeat (promoter region); F, forward primer; R, reverse primer; gag, group-specific antigen (capsid region); pol, polymerase (reverse transcription); env, envelope; tax, trans-activating region of the X gene.
†Reverse sequences are reversed and complementary to the proviral reference sequence. Primers were synthesized by Operon Biotechnologies, Huntsville, AL, USA.
‡Location according to reference sequence, GenBank accession no. EF600696.
§For both rounds of nested liquid-phase PCR, cycling conditions were as follows: 1 cycle at 95°C for 2 min; 30 cycles at 95°C for 30 s, XX°C for 30 s, 72°C for XX; and 1 cycle at 72°C for 5 min, where XX represents annealing temperature and extension times, respectively, provided for each primer pair. For both rounds of nested in situ PCR, conditions were as follows: 1 cycle at 92°C for 10 min, 1 cycle at 91°C for 2 min, XX°C for 1.5 min; then 30 cycles of 91°C for 30 s, XX°C for 1.5 min, 72°C for 2 min; and 1 cycle of 72°C for 10 min, where XX represents IS-PCR annealing temperatures indicated for each primer pair.
1Current affiliation: Texas A&M Health Science Center College of Medicine, College Station, Texas, USA.