Volume 20, Number 5—May 2014
Research
Bovine Leukemia Virus DNA in Human Breast Tissue
Table 4
Primers and reaction conditions for GAPDH gene amplifications used to verify quality of BLV DNA extracted from human breast tissue samples, human cell lines, and animal cell lines*
Gene | Primer pair sequences, 5′ → 3′† | Location in bp‡ | Product length, bp | Annealing temperature, °C§ | Extension time, s§ |
---|---|---|---|---|---|
Human GAPDH | F: GAGTCAACGGATTTGGTCGT | 194–213 | 237 | 50 | 22 |
R: TTGATTTTGGAGGGATCTCG | 431–412 | ||||
Mouse GAPDH | F: AGCTTGTCATCAACGGGAAG | 246–265 | 796 | 58 | 60 |
R: ATGTAGGCCATGAGGTCCAC | 1041–1022 | ||||
Bovine GAPDH | F: CCTTCATTGACCTTCACTACATGGTCTA | 172–199 | 857 | 59 | 60 |
R: GCTGTAGCCAAATTCATTGTCGTACCA | 1028–1002 |
*GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BLV, bovine leukemia virus; F, forward primer; R, reverse primer.
†Reverse sequences are reversed and complementary to the published genomic sequences. Primers were synthesized by Operon Biotechnologies, Huntsville, AL, USA.
‡Sequence bp numbering according to GenBank no. NM 002046.4 (human), XM 001476707.3 (mouse), and NM 001034034.2 (bovine).
§Cycling conditions were 1 cycle at 95°C for 2 min; 35 cycles at 95°C for 30 s; XX°C for 30 s, 72°C for XX sec; and 1 cycle at 72°C for 5 min, where XX represents annealing temperature and extension times, respectively, for primer pairs.
1Current affiliation: Texas A&M Health Science Center College of Medicine, College Station, Texas, USA.