Volume 20, Number 5—May 2014
Research
Bovine Leukemia Virus DNA in Human Breast Tissue
Table 4
Gene | Primer pair sequences, 5′ → 3′† | Location in bp‡ | Product length, bp | Annealing temperature, °C§ | Extension time, s§ |
---|---|---|---|---|---|
Human GAPDH | F: GAGTCAACGGATTTGGTCGT | 194–213 | 237 | 50 | 22 |
R: TTGATTTTGGAGGGATCTCG | 431–412 | ||||
Mouse GAPDH | F: AGCTTGTCATCAACGGGAAG | 246–265 | 796 | 58 | 60 |
R: ATGTAGGCCATGAGGTCCAC | 1041–1022 | ||||
Bovine GAPDH | F: CCTTCATTGACCTTCACTACATGGTCTA | 172–199 | 857 | 59 | 60 |
R: GCTGTAGCCAAATTCATTGTCGTACCA | 1028–1002 |
*GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BLV, bovine leukemia virus; F, forward primer; R, reverse primer.
†Reverse sequences are reversed and complementary to the published genomic sequences. Primers were synthesized by Operon Biotechnologies, Huntsville, AL, USA.
‡Sequence bp numbering according to GenBank no. NM 002046.4 (human), XM 001476707.3 (mouse), and NM 001034034.2 (bovine).
§Cycling conditions were 1 cycle at 95°C for 2 min; 35 cycles at 95°C for 30 s; XX°C for 30 s, 72°C for XX sec; and 1 cycle at 72°C for 5 min, where XX represents annealing temperature and extension times, respectively, for primer pairs.
1Current affiliation: Texas A&M Health Science Center College of Medicine, College Station, Texas, USA.
Page created: April 16, 2014
Page updated: April 16, 2014
Page reviewed: April 16, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.