Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 21, Number 4—April 2015
Research

Sequence Variability and Geographic Distribution of Lassa Virus, Sierra Leone

Tomasz A. Leski1Comments to Author , Michael G. Stockelman1, Lina M. Moses, Matthew Park, David A. Stenger, Rashid Ansumana, Daniel G. Bausch, and Baochuan Lin
Author affiliations: Naval Research Laboratory, Washington, DC, USA (T.A. Leski, M.G. Stockelman, D.A. Stenger, B. Lin); Tulane University, New Orleans, Louisiana, USA (L.M. Moses); Tulane School of Public Health and Tropical Medicine, New Orleans (L.M. Moses, D.G Bausch), Thomas Jefferson High School, Alexandria, Virginia, USA (M. Park); Mercy Hospital Research Laboratory, Bo, Sierra Leone (R. Ansumana); Liverpool School of Tropical Medicine, Liverpool, UK (R. Ansumana); Njala University, Bo (R. Ansumana)

Main Article

Table 1

PCR and sequencing primers used in study of Lassa virus, Sierra Leone*

Primer name Sequence, 5′ → 3′ Target gene Amplicon size Reference
1010C TCIGGIGAIGGITGGCC NP
 670 (17)
OW1696R AIATGAIGCAGTCCAIIAGTGCACAGTG (17)
LAS_NP_F_1 GGGTGGCCATAYATTGCATC 650
 This study
LAS_NP_R_1
 GTCCAGGAGTGCACAGTGAG
 This study
36E2 ACCGGGGATCCTAGGCATTT GPC
 317
 (24)
LVS339-rev
 GTTCTTTGTGCAGGAMAGGGGCATKGTCAT
 (24)
LVL3359-F AGAATYAGTGAAAGGGARAGCAATTC L 394 (28)
LVL3754-R CACATCATTGGTCCCCATTTACTRTGATC (28)

*GPC, glycoprotein precursor; L, polymerase; NP, nucleoprotein.

Main Article

References
  1. Frame  JD, Baldwin  JM Jr, Gocke  DJ, Troup  JM. Lassa fever, a new virus disease of man from West Africa. I. Clinical description and pathological findings. Am J Trop Med Hyg. 1970;19:670–6 .PubMedGoogle Scholar
  2. Sogoba  N, Feldmann  H, Safronetz  D. Lassa fever in West Africa: evidence for an expanded region of endemicity. Zoonoses Public Health. 2012;59(Suppl 2):43–7 . DOIPubMedGoogle Scholar
  3. Macher  AM, Wolfe  MS. Historical Lassa fever reports and 30-year clinical update. Emerg Infect Dis. 2006;12:835–7 . DOIPubMedGoogle Scholar
  4. Fichet-Calvet  E, Rogers  DJ. Risk maps of Lassa fever in West Africa. PLoS Negl Trop Dis. 2009;3:e388 . DOIPubMedGoogle Scholar
  5. Lukashevich  IS, Clegg  JC, Sidibe  K. Lassa virus activity in Guinea: distribution of human antiviral antibody defined using enzyme-linked immunosorbent assay with recombinant antigen. J Med Virol. 1993;40:210–7 . DOIPubMedGoogle Scholar
  6. McCormick  JB, Webb  PA, Krebs  JW, Johnson  KM, Smith  ES. A prospective study of the epidemiology and ecology of Lassa fever. J Infect Dis. 1987;155:437–44 . DOIPubMedGoogle Scholar
  7. McCormick  JB. Lassa fever. In: Saluzzo JF, Dodet B, editors. Emergence and control of rodent-borne viral diseases. Amsterdam: Elsevier; 1999. p. 177–95.
  8. Richmond  JK, Baglole  DJ. Lassa fever: epidemiology, clinical features, and social consequences. BMJ. 2003;327:1271–5 . DOIPubMedGoogle Scholar
  9. Monath  TP, Newhouse  VF, Kemp  GE, Setzer  HW, Cacciapuoti  A. Lassa virus isolation from Mastomys natalensis rodents during an epidemic in Sierra Leone. Science. 1974;185:263–5 . DOIPubMedGoogle Scholar
  10. Walker  DH, Wulff  H, Lange  JV, Murphy  FA. Comparative pathology of Lassa virus infection in monkeys, guinea-pigs, and Mastomys natalensis. Bull World Health Organ. 1975;52:523–34 .PubMedGoogle Scholar
  11. Smit  A, van der Bank  H, Falk  T, de Castro  A. Biochemical genetic markers to identify two morphologically similar South African Mastomys species (Rodentia: Muridae). Biochem Syst Ecol. 2001;29:21–30 . DOIPubMedGoogle Scholar
  12. Rosevear  DR. Muridae: typical rats & mice, wood mice, fat mice, swamp rats. In: Rosevear DR, editor. Rodents of West Africa. London: Trustees of the British Museum (Natural History); 1969. p. 227–496.
  13. Günther  S, Lenz  O. Lassa virus. Crit Rev Clin Lab Sci. 2004;41:339–90 . DOIPubMedGoogle Scholar
  14. Peters  CJ, Jahrling  PB, Liu  CT, Kenyon  RH, McKee  KT Jr, Barrera Oro  JG. Experimental studies of arenaviral hemorrhagic fevers. Curr Top Microbiol Immunol. 1987;134:5–68 . DOIPubMedGoogle Scholar
  15. Ter Meulen  J, Lukashevich  I, Sidibe  K, Inapogui  A, Marx  M, Dorlemann  A, Hunting of peridomestic rodents and consumption of their meat as possible risk factors for rodent-to-human transmission of Lassa virus in the Republic of Guinea. Am J Trop Med Hyg. 1996;55:661–6 .PubMedGoogle Scholar
  16. Lukashevich  I, Salvato  MS. Lassa virus genome. Curr Genomics. 2006;7:351–79. DOIGoogle Scholar
  17. Bowen  MD, Rollin  PE, Ksiazek  TG, Hustad  HL, Bausch  DG, Demby  AH, Genetic diversity among Lassa virus strains. J Virol. 2000;74:6992–7004 . DOIPubMedGoogle Scholar
  18. Safronetz  D, Sogoba  N, Lopez  JE, Maiga  O, Dahlstrom  E, Zivcec  M, Geographic distribution and genetic characterization of Lassa virus in sub-Saharan Mali. PLoS Negl Trop Dis. 2013;7:e2582 . DOIPubMedGoogle Scholar
  19. Ehichioya  DU, Hass  M, Becker-Ziaja  B, Ehimuan  J, Asogun  DA, Fichet-Calvet  E, Current molecular epidemiology of Lassa virus in Nigeria. J Clin Microbiol. 2011;49:1157–61 . DOIPubMedGoogle Scholar
  20. Lecompte  E, Fichet-Calvet  E, Daffis  S, Koulemou  K, Sylla  O, Kourouma  F, Mastomys natalensis and Lassa fever, West Africa. Emerg Infect Dis. 2006;12:1971–4 . DOIPubMedGoogle Scholar
  21. Günther  S, Emmerich  P, Laue  T, Kuhle  O, Asper  M, Jung  A, Imported Lassa fever in Germany: molecular characterization of a new Lassa virus strain. Emerg Infect Dis. 2000;6:466–76 . DOIPubMedGoogle Scholar
  22. Günther  S, Weisner  B, Roth  A, Grewing  T, Asper  M, Drosten  C, Lassa fever encephalopathy: Lassa virus in cerebrospinal fluid but not in serum. J Infect Dis. 2001;184:345–9 . DOIPubMedGoogle Scholar
  23. Trappier  SG, Conaty  AL, Farrar  BB, Auperin  DD, McCormick  JB, Fisher-Hoch  SP. Evaluation of the polymerase chain reaction for diagnosis of Lassa virus infection. Am J Trop Med Hyg. 1993;49:214–21 .PubMedGoogle Scholar
  24. Olschläger  S, Lelke  M, Emmerich  P, Panning  M, Drosten  C, Hass  M, Improved detection of Lassa virus by reverse transcription–PCR targeting the 5′ region of S RNA. J Clin Microbiol. 2010;48:2009–13 . DOIPubMedGoogle Scholar
  25. Demby  AH, Chamberlain  J, Brown  DW, Clegg  CS. Early diagnosis of Lassa fever by reverse transcription–PCR. J Clin Microbiol. 1994;32:2898–903 .PubMedGoogle Scholar
  26. Mills  JN, Childs  JE, Ksiazek  TG, Peters  CJ, Wallis  MV. Methods for trapping and sampling small mammals for virologic testing. Atlanta: US Department of Health and Human Services; 1995.
  27. Lecompte  E, Brouat  C, Duplantier  J-M, Galan  M, Granjon  L, Loiseau  A, Molecular identification of four cryptic species of Mastomys (Rodentia, Murinae). Biochem Syst Ecol. 2005;33:681–9. DOIGoogle Scholar
  28. Vieth  S, Drosten  C, Lenz  O, Vincent  M, Omilabu  S, Hass  M, RT-PCR assay for detection of Lassa virus and related Old World arenaviruses targeting the L gene. Trans R Soc Trop Med Hyg. 2007;101:1253–64 . DOIPubMedGoogle Scholar
  29. Leski  TA, Lin  B, Malanoski  AP, Wang  Z, Long  NC, Meador  CE, Testing and validation of high density resequencing microarray for broad range biothreat agents detection. PLoS ONE. 2009;4:e6569 . DOIPubMedGoogle Scholar
  30. Metzgar  D, Myers  CA, Russell  KL, Faix  D, Blair  PJ, Brown  J, Single assay for simultaneous detection and differential identification of human and avian influenza virus types, subtypes, and emergent variants. PLoS ONE. 2010;5:e8995 . DOIPubMedGoogle Scholar
  31. Tamura  K, Stecher  G, Peterson  D, Filipski  A, Kumar  S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–9 . DOIPubMedGoogle Scholar
  32. Huelsenbeck  JP, Ronquist  F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–5 . DOIPubMedGoogle Scholar
  33. Vieth  S, Torda  AE, Asper  M, Schmitz  H, Gunther  S. Sequence analysis of L RNA of Lassa virus. Virology. 2004;318:153–68 . DOIPubMedGoogle Scholar
  34. Lalis  A, Leblois  R, Lecompte  E, Denys  C, Ter Meulen  J, Wirth  T. The impact of human conflict on the genetics of Mastomys natalensis and Lassa virus in West Africa. PLoS ONE. 2012;7:e37068 . DOIPubMedGoogle Scholar
  35. ter Meulen  J, Lenz  O, Koivogui  L, Magassouba  N, Kaushik  SK, Lewis  R, Short communication: Lassa fever in Sierra Leone: UN peacekeepers are at risk. Trop Med Int Health. 2001;6:83–4 . DOIPubMedGoogle Scholar
  36. Shaffer  JG, Grant  DS, Schieffelin  JS, Boisen  ML, Goba  A, Hartnett  JN, Lassa fever in post-conflict Sierra Leone. PLoS Negl Trop Dis. 2014;8:e2748 . DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this article.

Page created: March 17, 2015
Page updated: March 17, 2015
Page reviewed: March 17, 2015
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external