Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 26, Number 8—August 2020

Synopsis

US CDC Real-Time Reverse Transcription PCR Panel for Detection of Severe Acute Respiratory Syndrome Coronavirus 2

Xiaoyan Lu, Lijuan Wang, Senthilkumar K. Sakthivel, Brett Whitaker, Janna Murray, Shifaq Kamili, Brian Lynch, Lakshmi Malapati, Stephen A. Burke, Jennifer Harcourt, Azaibi Tamin, Natalie J. Thornburg, Julie M. Villanueva, and Stephen LindstromComments to Author 
Author affiliations: Centers for Disease Control and Prevention, Atlanta, Georgia, USA (X. Lu, B. Whitaker, S.A. Burke, J. Harcourt, A. Tamin, N.J. Thornburg, J.M. Villanueva, S. Lindstrom); Synergy America, Inc., Atlanta (L. Wang, S. Kamili); Eagle Contracting, Atlanta (S.K. Sakthivel, J. Murray, B. Lynch); Leidos, Atlanta (L. Malapati); Battelle, Atlanta (S.A. Burke)

Main Article

Table 1

Assay primer/probe sequences for the US CDC rRT-PCR panel for detection of SARS-CoV-2*

Assay Genome target Genome location Primers and probes† Sequence, 5′→3′ Amplicon size, bp Assay use
N1
Nucleocapsid gene
28303–28322‡ Forward primer GACCCCAAAATCAGCGAAAT 73
SARS-CoV-2
28374–28351‡ Reverse primer TCTGGTTACTGCCAGTTGAATCTG
28325–28348‡
Probe
ACCCCGCATTACGTTTGGTGGACC
N2
Nucleocapsid gene
29180–29199‡ Forward primer TTACAAACATTGGCCGCAAA 67
SARS-CoV-2
29246–29228‡ Reverse primer GCGCGACATTCCGAAGAA
29204–29226‡
Probe
ACAATTTGCCCCCAGCGCTTCAG
N3
Nucleocapsid gene
28697–28718‡ Forward primer GGGAGCCTTGAATACACCAAAA 72
SARS-CoV-2,
SARS-CoV, and other Sarbecoviruses§
28768–28748‡ Reverse primer TGTAGCACGATTGCAGCATTG
28720–28743‡
Probe
AYCACATTGGCACCCGCAATCCTG
RP¶ Human RNase P gene 50–68# Forward primer AGATTTGGACCTGCGAGCG 65 Sample quality control
114–95# Reverse primer GAGCGGCTGTCTCCACAAGT
71–93# Probe TTCTGACCTGAAGGCTCTGCGCG

*CDC, Centers for Disease Control and Prevention; N, nucleocapsid protein gene; RP, ribonuclease P gene; rRT-PCR, real-time reverse transcription PCR; SARS-CoV-2, severe acute respiratory coronavirus 2.
†Probes labeled at the 5′-end with the reporter molecule 6-carboxyfluorescein (FAM) and at the 3′-end with Black Hole Quencher 1 (Biosearch Technologies Inc., https://www.biosearchtech.com).
‡Nucleotide numbering based on SARS-CoV-2 (accession no. MN908947).
§Bat- and civet-SARS–like coronaviruses.
¶Primer/probe sequences from (10).
#Nucleotide numbering based on human RP mRNA (accession no. NM_006413).

Main Article

References
  1. World Health Organization. Pneumonia of unknown cause–China [cited 2020 Mar 1]. https://www.who.int/csr/don/05-january-2020-pneumonia-of-unkown-cause-china
  2. Zhu  N, Zhang  D, Wang  W, Li  X, Yang  B, Song  J, et al.; China Novel Coronavirus Investigating and Research Team. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med. 2020;382:727–33. DOIPubMedGoogle Scholar
  3. Zhang  Y-Z. Novel 2019 coronavirus genome. Virological. 2020 Jan 10 [cited 2020 Mar 1]. http://virological.org/t/novel-2019-coronavirus-genome/319
  4. Lu  R, Zhao  X, Li  J, Niu  P, Yang  B, Wu  H, et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020;395:565–74. DOIPubMedGoogle Scholar
  5. Chan  JF, Kok  KH, Zhu  Z, Chu  H, To  KK, Yuan  S, et al. Genomic characterization of the 2019 novel human-pathogenic coronavirus isolated from a patient with atypical pneumonia after visiting Wuhan. Emerg Microbes Infect. 2020;9:221–36. DOIPubMedGoogle Scholar
  6. Holshue  ML, DeBolt  C, Lindquist  S, Lofy  KH, Wiesman  J, Bruce  H, et al.; Washington State 2019-nCoV Case Investigation Team. Washington State 2019-nCoV Case Investigation Team. First case of 2019 novel coronavirus in the United States. N Engl J Med. 2020;382:929–36. DOIPubMedGoogle Scholar
  7. World Health Organization. Coronavirus disease 2019 (COVID-19) situation report-93 [cited 2020 Apr 22]. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200422-sitrep-93-covid-19.pdf?sfvrsn=35cf80d7_4
  8. Harcourt  J, Tamin  A, Lu  X, Kamili  S, Sakthivel  SK, Murray  J, et al. Severe acute respiratory syndrome coronavirus 2 from patient with 2019 novel coronavirus disease, United States. Emerg Infect Dis. 2020 Mar 11 [Epub ahead of print].
  9. Centers for Disease Control and Prevention. Health Alert Network: update and interim guidance on outbreak of 2019 novel coronavirus (2019-nCoV) in Wuhan, China [cited 2020 Apr 16]. https://emergency.cdc.gov/han/han00426.asp
  10. Emery  SL, Erdman  DD, Bowen  MD, Newton  BR, Winchell  JM, Meyer  RF, et al. Real-time reverse transcription-polymerase chain reaction assay for SARS-associated coronavirus. Emerg Infect Dis. 2004;10:311–6. DOIPubMedGoogle Scholar
  11. Centers for Disease Control and Prevention. CDC 2019-novel coronavirus (2019-nCoV) real-time RT-PCR diagnostic panel [cited 2020 Mar 1]. https://www.fda.gov/media/134922/download
  12. Lu  X, Whitaker  B, Sakthivel  SK, Kamili  S, Rose  LE, Lowe  L, et al. Real-time reverse transcription-PCR assay panel for Middle East respiratory syndrome coronavirus. J Clin Microbiol. 2014;52:67–75. DOIPubMedGoogle Scholar
  13. Moreno  JL, Zúñiga  S, Enjuanes  L, Sola  I. Identification of a coronavirus transcription enhancer. J Virol. 2008;82:3882–93. DOIPubMedGoogle Scholar
  14. Chu  DKW, Pan  Y, Cheng  SMS, Hui  KPY, Krishnan  P, Liu  Y, et al. Molecular diagnosis of a novel coronavirus (2019-nCoV) causing an outbreak of pneumonia. Clin Chem. 2020;66:549–55. DOIPubMedGoogle Scholar
  15. Zhou  P, Yang  XL, Wang  XG, Hu  B, Zhang  L, Zhang  W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020;579:270–3. DOIPubMedGoogle Scholar
  16. Al-Abdely  HM, Midgley  CM, Alkhamis  AM, Abedi  GR, Lu  X, Binder  AM, et al. Middle East respiratory syndrome coronavirus infection dynamics and antibody responses among clinically diverse patients, Saudi Arabia. Emerg Infect Dis. 2019;25:753–66. DOIPubMedGoogle Scholar
  17. Zou  L, Ruan  F, Huang  M, Liang  L, Huang  H, Hong  Z, et al. SARS-CoV-2 viral load in upper respiratory specimens of infected patients. N Engl J Med. 2020;382:1177–9. DOIPubMedGoogle Scholar
  18. Hamming  I, Timens  W, Bulthuis  ML, Lely  AT, Navis  G, van Goor  H. Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J Pathol. 2004;203:631–7. DOIPubMedGoogle Scholar
  19. Chan  KH, Poon  LL, Cheng  VC, Guan  Y, Hung  IF, Kong  J, et al. Detection of SARS coronavirus in patients with suspected SARS. Emerg Infect Dis. 2004;10:294–9. DOIPubMedGoogle Scholar
  20. Grant  PR, Garson  JA, Tedder  RS, Chan  PK, Tam  JS, Sung  JJ. Detection of SARS coronavirus in plasma by real-time RT-PCR. N Engl J Med. 2003;349:2468–9. DOIPubMedGoogle Scholar
  21. Wölfel  R, Corman  VM, Guggemos  W, Seilmaier  M, Zange  S, Müller  MA, et al. Virological assessment of hospitalized cases of coronavirus disease 2019. Nature. 2020; [Epub ahead of print]. DOIGoogle Scholar
  22. Kujawski  SA, Wong  KK, Collins  JP; COVID-19 Investigation Team. Clinical and virologic characteristics of the first 12 patients with coronavirus disease 2019 (COVID-19) in the United States. Nat Med. 2020; [Epub ahead of print].PubMedGoogle Scholar
  23. Nalla  AK, Casto  AM, Huang  MW, Perchetti  GA, Sampoleo  R, Shrestha  L, et al. Comparative performance of SARS-CoV-2 detection assays using seven different primer/probe sets and one assay kit. J Clin Microbiol. 2020;JCM.00557-20; Epub ahead of print. DOIPubMedGoogle Scholar
  24. Li  X, Wang  W, Zhao  X, Zai  J, Zhao  Q, Li  Y, et al. Transmission dynamics and evolutionary history of 2019-nCoV. J Med Virol. 2020;92:501–11. DOIPubMedGoogle Scholar

Main Article

Page created: May 14, 2020
Page updated: July 17, 2020
Page reviewed: July 17, 2020
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external