Volume 30, Number 9—September 2024
Research
Loop-Mediated Isothermal Amplification Assay to Detect Invasive Malaria Vector Anopheles stephensi Mosquitoes
Table 1
Looped primers designed by using the NEB LAMP Primer Design Tool targeting Anopheles stephensi mosquito ITS2 sequence regions for development of colorimetric LAMP assay to detect invasive malaria vector An. stephensi mosquitoes*
| Sequence | 5′ | 3′ | Primer sequence | Primer concentration |
|---|---|---|---|---|
| F3 | 333 | 351 | ATTGCACGGGGACTTCCA | 5 µM |
| B3 | 504 | 524 | GCCTACAGACTCCACTGTCA | 5 µM |
| FIP | CGACTGCAACTGTATGCGAGGACGGGTCGAGTAACACTTGC | 20 µM | ||
| BIP | CCGTGTGGGTGAGTGAGGTTAGAATGATGCGACGGGAGAAG | 20 µM | ||
| LF | 383 | 401 | AAGATACGAGCGCGTTGGG | 10 µM |
| F1c† | 402 | 423 | CGACTGCAACTGTATGCG | |
| F2† | 359 | 380 | GGACGGGTCGAGTAACACTTGC | |
| B2† | 439 | 461 | CCGTGTGGGTGAGTGAGGTTAG | |
| B1c† | 485 | 502 | AATGATGCGACGGGAGAAG |
*ITS, internal transcribed spacer; LAMP, loop-mediated isothermal amplification; NEB, New England Biolabs, https://www.neb.com. †Primers not needed for LAMP assay.
Page created: July 10, 2024
Page updated: August 20, 2024
Page reviewed: August 20, 2024
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.