Volume 20, Number 10—October 2014
Research
Clinical Isolates of Shiga Toxin 1a–Producing Shigella flexneri with an Epidemiological Link to Recent Travel to Hispañiola
Table 2
Primer pairs used for PCR analysis
| Primer pair | Sequence, 5′ → 3′ | Amplicon size, bp | Source |
|---|---|---|---|
| stx1-det-F1 | GTACGGGGATGCAGATAAATCGC | 698 | (14) |
| stx1-seq-R1 | GAAGAAGAGACTGAAGATTCCATCTG | ||
| stx2_F4 | GGCACTGTCTGAAACTGCTCCTGT | 627 | (14) |
| stx2R1 | ATTAAACTGCACTTCAGCAAATCC | ||
| VirF1 | GCAAATACTTAGCTTGTTGCACAGAG | 907 | This study |
| VirF2 | GGGCTTGATATTCCGATAAGTC | ||
| VirB01 | TTCTACCATCAATCTCCCTTCC | 897 | This study |
| IpaAFwd | GTATCTAGCGCCCTCAGCAAG | ||
| IpaHF | GCGTTCCTTGACCGCCTTTCCGATACCG | 628 | This study |
| IpaHR | CTTTCAGCCGGTCAGCCACCCTCTGAGAG | ||
| Stx1R2 | AGCGAATGACATTCAGCGAATCTA | 1,059 | This study |
| Phage_stxR2 | GACGCCATACAAGGAGTC | ||
| Stx1F2 | ACGCCTGATTGTGTAACTGGAAA | 1,333 | This study |
| Phage_stx1F2 | CACTCGCGTCACTGTATG | ||
| Stx_phage_up | GACCGCACACTGTGCTATC | 1,155 | This study |
| S1742 up | CCGTGCGGGTATTTAACAATAATGG | ||
| Stx_phage_dn | AGTCAAACCGCGCTATTGG | 1,224 | This study |
| S1742 dn | TGCATGACAGAGGCAATAAACCCGAT | ||
| RecAko-site1 | GCTATCGACGAAAACAAACAGAAAGCGTTGGCGGCAGCACTGGGCCAGATTGTGTAGGCTGGAGCTGCTTC | 1,609 | This study |
| RecAko-site2 | AAAATCTTCGTTAGTTTCTGCTACTCCTTCGCTGTCATCTACAGAGAAATCCATATGAATATCCTCCTTA | ||
| RecA-1 | ACATATTGACTATCCGGTATTACCCGG | 1,148, 1,701* | This study |
| RecA-3 | GACCGTCCGTGCACACATTATCTATT |
*Amplicon sizes for wild-type recA or insertion of kan cassette into recA, respectively.
Page created: September 12, 2014
Page updated: September 12, 2014
Page reviewed: September 12, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.