Volume 11, Number 3—March 2005
Research
Rapid Identification of Emerging Pathogens: Coronavirus
Table 2
PCR primer pairs used in this study*
Primer name | Gene name | Product name | Genome coordinates | Orientation | Product length (bp) | Sequence (5′ to >3′) |
---|---|---|---|---|---|---|
RdRp primer | ORF 1b | Nsp12-pp1ab (RdRp) | 15146–15164 | Sense | 88 | TAAGTTTTATGGCGGCTGG |
15213–15233 | Antisense | TTTAGGATAGTCCCAACCCAT | ||||
Nsp14 primer | ORF 1b | Nsp14-pp1ab (nuclease ExoN homolog) | 19113–19138 | Sense | 137 | TGTTTGTTTTGGAATTGTAATGTTGA |
19225–19249 | Antisense | TGGAATGCATGCTTATTAACATACA |
*All coordinates are based on SARS TOR2 genome (GenBank accession no. NC_004718.3). 5′ propynyl-modified pyrimidine nucleotides are shown in bold. Each primer was designed to include a thymidine (T) nucleotide on the 5′ end to minimize addition of nontemplated adenosine (A) during polymerase chain reaction (PCR) (data not shown). RdRp, RNA-dependent RNA polymerase.