Volume 11, Number 3—March 2005
Research
Rapid Identification of Emerging Pathogens: Coronavirus
Rangarajan Sampath*
, Steven A. Hofstadler*, Lawrence B. Blyn*, Mark W. Eshoo*, Thomas A. Hall*, Christian Massire*, Harold M. Levene*, James C. Hannis*, Patina M. Harrell*, Benjamin Neuman†, Michael J. Buchmeier†, Yun Jiang*, Raymond Ranken*, Jared J. Drader*, Vivek Samant*, Richard H. Griffey*, John A. McNeil*, Stanley T. Crooke*, and David J. Ecker*
, Steven A. Hofstadler*, Lawrence B. Blyn*, Mark W. Eshoo*, Thomas A. Hall*, Christian Massire*, Harold M. Levene*, James C. Hannis*, Patina M. Harrell*, Benjamin Neuman†, Michael J. Buchmeier†, Yun Jiang*, Raymond Ranken*, Jared J. Drader*, Vivek Samant*, Richard H. Griffey*, John A. McNeil*, Stanley T. Crooke*, and David J. Ecker*
Table 2
PCR primer pairs used in this study*
| Primer name | Gene name | Product name | Genome coordinates | Orientation | Product length (bp) | Sequence (5′ to >3′) |
|---|---|---|---|---|---|---|
| RdRp primer | ORF 1b | Nsp12-pp1ab (RdRp) | 15146–15164 | Sense | 88 | TAAGTTTTATGGCGGCTGG |
| 15213–15233 | Antisense | TTTAGGATAGTCCCAACCCAT | ||||
| Nsp14 primer | ORF 1b | Nsp14-pp1ab (nuclease ExoN homolog) | 19113–19138 | Sense | 137 | TGTTTGTTTTGGAATTGTAATGTTGA |
| 19225–19249 | Antisense | TGGAATGCATGCTTATTAACATACA |
*All coordinates are based on SARS TOR2 genome (GenBank accession no. NC_004718.3). 5′ propynyl-modified pyrimidine nucleotides are shown in bold. Each primer was designed to include a thymidine (T) nucleotide on the 5′ end to minimize addition of nontemplated adenosine (A) during polymerase chain reaction (PCR) (data not shown). RdRp, RNA-dependent RNA polymerase.
Page created: April 25, 2012
Page updated: April 25, 2012
Page reviewed: April 25, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.